User:Margarida Gama-Carvalho/Notebook/Undergrad teaching/2010/03/23

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

PCR e RT-PCR

Questões

  • Que características deve ter um primer de PCR?.

Un primer de PCR deve ter entre 16-25 nucleótidos, ter um conteúdo em GC e AT equilibrado e uma temperatura de dissociação relativamente elevada. Adicionalmente, deve apenas hibridar com a sua sequência alvo e não formar híbridos intramoleculares nem intermoleculares com os outros primers. Para um PCR são necessários dois pares de primers que devem hibridar na extremidade 3' de cada uma das cadeias da região alvo a amplificar.


  • Como qualquer DNA polimerase, a transcriptase reversa requer um primer iniciador, que pode ser de 3 tipos distintos: específico de gene, oligo-dT ou random (uma mistura aleatória de 6 a 8 nucleótidos). Em que situações pode ser utilizado cada um destes primers e que vantagens/desvantagens relativas apresentam?

1. Específico de gene: só serve para a transcrição reversa do RNA alvo; melhora a especificidade do processo mas é pouco prático quando se quer estudar vários alvos diferentes em simultâneo.

2. Oligo-dT: só serve para a transcrição reversa de RNAs poliadenilados (em geral mRNA). Permite obter uma amostra de cDNA onde se pode estudar em simultâneo a expressão de vários mRNAs de interesse, mas aumenta a possibilidade de reuído de fundo na fase do PCR e não permite estudar a expressão de RNAs não poliadenilados.

3. Random: permite fazer a trasncrição reversa de todos os RNAs presentes na amostra, no entanto, aumenta o potencial para ruído de fundo na amplificação por PCR e tem uma baixa eficiência para estudo de mRNAs, por serem muito menos abundantes na célula do que os RNAs ribossomais e tRNAs.


  • Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.

Há várias estratégias possíveis. Considerando que se pretende apenas estabelecer um método robusto para identificar as duas mutações referenciadas nos nucleótidos 462 e 732:

1. Aquisição de um par de primers que permite amplificar um fragmento do gene da beta-globina com 496bps, com as seguintes características ( desenhados com o programa Primer 3 usando a "Human mispriming database" para garantir especificidade:

Primer Início Tamanho Tmelting %GC Sequência
Fw (Left) 363 20 59.96 50.00 GAAGGCTCATGGCAAGAAAG
Rev (Right) 858 25 59.37 32.00 GCAAATAAGCACACATATATTCCAA

2. Isolamento de DNA genómico a partir de células da mucosa bucal.

3. Realização de uma reacção de PCR com os seguintes componentes:

Reagente Volume/quantidade
DNA 1μg
Primer Fw 1μM
Primer Rev 1μM
dNTP 0.2mM
Tampão 10x 5μL
Taq polimerase 1.25U
H2O até 50μL

... e as seguintes condições:

Passo Temperatura Tempo Nº de ciclos
Desnaturação inicial 95ºC 1min 1x
Desnaturação 95ºC 30s
Annealing 55ºC 30s
Elongação 72ºC 30s 35x
Extensão final 72ºC 5min 1x

4. Purificação do produto de PCR

5. Realização de uma reacção de sequenciação com o primer Fw.

(De notar que a distância entre o local de hibridação do primer Fw e a primeira mutação é compatível com a sua identificação por sequenciação.


  • Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.

O estudo da expressão deverá ser realizado pela técnica de RT-PCR. Como um dos objectivos poderá ser a detecção de problemas no processo de splicing, propõe-se o design de primers complementares ao 1º e último exão, que poderão amplificar diversos transcritos. Da mesma forma, propõe-se uma reacção de trasncrição reversa com Random priming, permitindo a eventual detecção da presença de transcritos primários independentemente da acumulação de níveis elevados de mRNA. Assim o procedimento envolverá:

1. Isolamento de RNA total a partir de uma amostra de sangue:

2. Tratamento das amostras com DNAse I de forma a eliminar contaminações de DNA genómico.

3. Reacção de transcrição reversa com os seguintes componentes

Reagente Volume/quantidade
RNA 1μg
Random Primer 0.2μM
Inibidor de RNase 0.5μM
dNTP 1mM
Tampão 5x 4μL
Transcritase reversa 1μL
H2O 12.5μL

... e as seguintes condições:

Passo Temperatura Tempo
Annealing 25ºC 10min
Elongação 42ºC 60min
Inactivação 70ºC 10min

4. Aquisição de um par de primers que permite amplificar os transcritos do gene da beta-globina ( desenhados com o programa Primer 3 usando a "Human mispriming database" para garantir especificidade:

Primer Posição no mRNA Tamanho Tmelting %GC Sequência
Fw (Left) 113 (Exão 1) 20 60.36 55.00 GGATGAAGTTGGTGGTGAGG
Rev (Right) 392 (Exão 3) 19 59.91 57.89 CACACAGACCAGCACGTTG

5. Reacção de PCR semelhante à descrita anteriormente, usando 1μL do produto de transcrição reversa e um tempo de extensão de 90 segundos.

Produto esperado para a amplificação do mRNA normal: 280bp. Produto esperado para a amplificação do pre-mRNA: 1260bp.

6. Análise dos produtos de RT-PCR por electroforese.




Personal tools