User:Maria Ines Goncalves/Notebook/Aulas Biologia Molecular 2010/2010/03/23

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

PCR e RT-PCR

Introdução

A técnica do PCR permite obter um grande número de cópias de uma sequência de DNA de interesse a partir de uma quantidade mínima de material. Nas aplicações de maior sensibilidade, uma única molécula de DNA pode ser suficiente para gerar milhões de cópias. Este é por isso o método base para um número muito grande de técnicas de diagnóstico molecular, incluindo em particular os diagnósticos que requerem sequenciação de DNA.

A seguinte animação explica o funcionamento da técnica: PCR

Quando é necessário proceder à caracterização da expressão de genes, é também possível aplicar a técnica de PCR acoplando-a a uma reacção de transcrição reversa, como explicado na seguinte animação: RT-PCR

Note que o resultado de um ensaio de PCR ou RT-PCR tem geralmente de ser visualisado por separação electroforética dos produtos de reacção.


Questões

  • Que características deve ter um primer de PCR?

Comprimento do primer (18 a 22 pb); Temperatura de desnaturação entre 52-58ºC; Conteúdo em GC (40-60%) - influencia a temperatura de desnaturação; Presença de G ou C nas últimas 5 bases do terminal 3' - estabilidade do terminal; Não ter estruturas secundárias (ex. hairpins); Evitar repetições de nucleótidos; Evitar homologia cruzada.


  • Como qualquer DNA polimerase, a transcriptase reversa requer um primer iniciador, que pode ser de 3 tipos distintos: específico de gene, oligo-dT ou random (uma mistura aleatória de 6 a 8 nucleótidos). Em que situações pode ser utilizado cada um destes primers e que vantagens/desvantagens relativas apresentam?

Específico de gene: sequência complementar a um determinado gene de interesse; Vantagem: produção de cDNA correspondente apenas ao gene que se quer estudar, poupando análise de informação desnecessárias; Desvantagem: no estudo de vários genes em simultâneo não é possível pois só são obtidos os resultados do gene para o qual o primer é específico;


Oligo-dT: desoxinucleótido de timina que hibrida com mRNA num terminal 3' poli-A; Vantagem: com uma única reacção de RT-PCR todos os mRNA são convertidos em cDNA; Desvantagem: como os oligo-dT estão ligados ao terminal, sequências demasiado longas podem não ser convertidas e, além disto, todos os RNA que não tenham a cauda poli-A não são obtidas em cDNA;

Random: usado para gerar cDNA a partir de uma amostra de RNA; Vantagem: melhor obtenção e distribuição das regiões codificantes e não-codificantes; Desvantagem: produção de cDNA de todos os RNA e não apenas de mRNA e com dimensões variáveis, imprevisíveis e que podem ser incompletas e insuficientes.


  • Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.


É possível identificar mutações presentes no gene em questão recorrendo à técnica de PCR e posterior sequênciação. O procedimento experimental deve ser aplicado a cada um dos indivíduos da família para uma comparação final que permite, então, a identificação das mutações.

1) Amostra biológica: células da mucosa bucal – esfregaço -> hidrólise ácida das células.


2) Design dos primers que permitam amplificar a cadeia (PCR)

OLIGO start len tm gc% any 3' rep seq

LEFT PRIMER 118 20 58.82 50.00 4.00 1.00 10.00 CATATTCTGGAGACGCAGGA

RIGHT PRIMER 2112 20 59.67 45.00 7.00 3.00 11.00 TGCTCAAGGCCCTTCATAAT



3) PCR (temos falta de material): primer, segmento a amplificar, o q precisamos Material: Amostra de DNA; 2 primers (forward e reverse); Taq polimerase; Mix de dNTPs; Tampão; Água.


4) Purificação do DNA para “limpar” as sequências correspondentes aos primers


5) Design dos primers que permitam a sequenciação

OLIGO start len tm gc% any 3' rep seq

LEFT PRIMER 118 20 58.82 50.00 4.00 1.00 10.00 CATATTCTGGAGACGCAGGA


600-650

OLIGO start len tm gc% any 3' rep seq

LEFT PRIMER 1498 24 58.81 37.50 6.00 2.00 12.00 TGTACACATATTGACCAAATCAGG


1000-1200

OLIGO start len tm gc% any 3' rep seq

LEFT PRIMER 1049 20 59.94 45.00 2.00 0.00 10.00 ATGGGACGCTTGATGTTTTC


1600-1800

OLIGO start len tm gc% any 3' rep seq

LEFT PRIMER 512 20 60.21 50.00 2.00 2.00 11.00 GGCATAAAAGTCAGGGCAGA


6) Sequenciação: É necessária a cadeia de DNA a sequenciar (DNA template), um primer (que é complementar à sequência de DNA), DNA polimerase (enzima) e os 4 desoxinucleótidos - dNTP (A, T, C e G). À mistura também se adiciona outro tipo de nucleótidos, didesoxinucleótidos (ddNTP).


7) Análise de resultados – comparação dos resultados da sequenciação com a sequência referência (BLAST).



  • Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.



Personal tools