User:Mbennie/Notebook/Oligos/6His Tag-R

From OpenWetWare

Jump to: navigation, search

Sequence: gtttcttcctgcagcggccgctactagtaccgtgatggtgatggtgatgac

Binding site: 21 bp

Predicted Tm: 53.1C

Received: 8/16/2007

  • Resuspended at 50uM with 330.2ul of TE
Personal tools