User:Mbennie/Notebook/Oligos/IgAbfull-F

From OpenWetWare

Jump to: navigation, search

Sequence: gtttcttcgaattcgcggccgcttctagaggttcgccatcatttgattcatcag

Binding site: 22 bp

Predicted Tm: 54.9C

Received: 8/9/2007

  • Resuspended at 50uM with 386ul of TE
Personal tools