User:Mbennie/Notebook/Oligos/Mut2 Pst1b-R

From OpenWetWare

Jump to: navigation, search

Sequence: gctcttcaagcagataacaagggttttacggtaaggt

Binding site: 26 bp

Predicted Tm: 54.3C

Received: 8/15/2007

  • Resuspended at 50uM with 638.2ul of TE
Personal tools