User:Mbennie/Notebook/Sequencing/8.6.2007

From OpenWetWare

Jump to: navigation, search

Template: 8ul DNA, .3ul primer, 1.7 ul water

  • IgAss2 with VF2
    • No significant similarity
NNNNNNNNNNNTNNNTATNNNAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGA
TGATTTCTGGAATTCGCGGGACTCGGCATGAACATGTTCGAACAGCAGCAGTGACGTGGTGCGCCCGCGGTCAAACACTT
CGCACCATTCGGCCTGTTTATCCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCG
AAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATC
AGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGC
AAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAAT
CGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCG
CTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCT
CACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGAC
CGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGG
TAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAA
GAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAA
ACCACCGCTGGTAGCGGNGNNNTTTTTGTTTGCAGCAGCNNATTACGCGCANAAAAANNGNTCTCAGANATCCTTTGNTC
TTTNTANNNNCTGACNCTCANTGNNNNAAACTCACGTTAANNNNTTNGNCATNANNTNTCAAANGATCNTNNCNAGATCT
TTNNNNNNNAANNNNTTTTNAATNANNNAANNNNNNNNNNNNCTGNNNNNNNNNNNNNCTNNANNCNCNCNNNAANNNNN
NGGNNCNNNNGNNNNNNANNAANNNNNGGNNNNNNNNGNNNNNNNNNNNGGANNNTNNNACNNNGNNNNNNN
  • IgAss3 with VF2
    • 100% correct
NNNNNNNNNNNTNNNNATANAAATAGGCGTATTACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGA
TGATTTCTGGAATTCGCGGCCGCTTCTAGATGAAAGCCAAACGTTTTAAAATTAACGCCATATCCTTATCCATCTTTCTT
GCCTATGCCCTTACGCCATACTCAGAAGCGGGTACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACC
ACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGG
TCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGA
AAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCG
CCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT
TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCG
GGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGT
GCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACT
TATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGNGCTACAGAGTTCTTGAAGTGG
TGGCCTAACTACNGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCNGAAAAGAGTT
GGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGNNGNTTTTTGNTTGCAGCAGCNNATTACGCGCANAAAAA
GNANCTCAGANATCCTTGATCTTTCTANGGGTCTGANNCTCANNGNANNAANNTCANGTNAANGATTNTNGNCANNANAN
TNNTCNANNANGNNNNTTNNCNANANCTNNANNNNNANGNANNNNANCAANCNNNNNNNNNNNNNAACNNNNNGNNANNN
NNNNNNNNNNNNNNNNNNNAAANNNCNNNNNNNNCNNNNNTNNTNNAANANNNNNNNNNNNGNNN
  • IgAbc1-F with VF2

Missing part 2

NNNNNNNNNNANNTATAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGA
TTTCTGGAATTCGCGGCCGCTTCTAGAGGTAGCACGCAATCTATCTTGTTGGATACAGGTGCTTCATTAACACGGCACAT
TGCACAAAAATCACGCGCTGATGCCGAAAAAAACAGTGTTTGGATGTCAAACACCGGTTATGGCCGTGATTATGCTTCCG
CACAATATCGCCGGTTTAGTTCGAAACGCACGCAAACACAAATCGGCATTGACCGCAGCTTGTCCGAAAATATGCAGATA
GGCGGAGTATTGACTTACTCTGACAGTCAGCATACTTTTGATCAGGCGGGCGGCAAAAATACTTTTGTGCAAGCCAACCT
TTATGGTAAGTATTATTTAAATGATGCTTGGTATGTGGCCGGCGATATTGGTGCGGGCAGCTTGAGAAGCCGGTTACAAA
CGCAGCAAAAAGCAAACTTTAACCGAACAAGCATCCAAACCGGCCTTACTTTGGGCAATACGCTGAAAATCAATCAATTC
GAGATTGTCCCTAGTGCGGGTATCCGTTACAGCCGCCTGTCATCTGCCTGAAGAGCTCTTCAGCCGCTTACTTTGCCAAT
TATGGCAAAGGCGGCGTGAATGTGGGCGGTAAATCCTTCGCCTATAAAGCAGATAATCAACAGCAATATTCAGCAGGCGC
CGCGTTACTGTACCGTAATGTTACATTAAACGTAAATGGCAGTATTACAAAAGGAAAACAATTGGAAAAACAAAAATCCG
GACAAATTAAAATACAGATTCGTTTCTAATAATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAGGGCAAGGTGTCACCA
CCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCANGCTTCCTCGCTCACTGACTCGCTGCGCTCGGT
CGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTANNACGGTNATCNCAGAATCNGGGGANACGNNGAAAGA
ACNTGNNAGCAAAGNCAGCNAAAGNCNGNANCGTAAAANGCNNCGTTGCTGGNGTTTTNCACNGNNCCGNCCCCCNGANN
ANNNTNANNAAAATCGANNNTCAAGNCNNNGGNGNNNAANCNNNNNNNNNNNTNAANANNNNCNGNNNNNTCNNNNNNNN
NNNNNNNNCNNNNNNNNNNNNNNNNNNNNACCNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNTNNNNTNNNNNGNNNNNN
NNNGNNNTTTNNNNTANNNNNNNNNNNNNNN
  • IgAbc1-R with VR

Missing part 2

NNNNNNNNCNNANNNACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCATAACGCGAAGTAATCTTTTCGGTTT
TAAAGAAAAAGGGCAGGGTGGTGACACCTTGCCCTTTTTTGCCGGACTGCAGCGGCCGCTACTAGTATTATTAGAAACGA
ATCTGTATTTTAATTTGTCCGGATTTTTGTTTTTCCAATTGTTTTCCTTTTGTAATACTGCCATTTACGTTTAATGTAAC
ATTACGGTACAGTAACGCGGCGCCTGCTGAATATTGCTGTTGATTATCTGCTTTATAGGCGAAGGATTTACCGCCCACAT
TCACGCCGCCTTTGCCATAATTGGCAAAGTAAGCGGCTGAAGAGCTCTTCAGGCAGATGACAGGCGGCTGTAACGGATAC
CCGCACTAGGGACAATCTCGAATTGATTGATTTTCAGCGTATTGCCCAAAGTAAGGCCGGTTTGGATGCTTGTTCGGTTA
AAGTTTGCTTTTTGCTGCGTTTGTAACCGGCTTCTCAAGCTGCCCGCACCAATATCGCCGGCCACATACCAAGCATCATT
TAAATAATACTTACCATAAAGGTTGGCTTGCACAAAAGTATTTTTGCCGCCCGCCTGATCAAAAGTATGCTGACTGTCAG
AGTAAGTCAATACTCCGCCTATCTGCATATTTTCGGACAAGCTGCGGTCAATGCCGATTTGTGTTTGCGTGCGTTTCGAA
CTAAACCGGCGATATTGTGCGGAAGCATAATCACGGCCATAACCGGTGTTTGACATCCAAACACTGTTTTTTTCGGCATC
AGCGCGTGATTTTTGTGCAATGTGCCGTGTTAATGAAGCACCTGTATCCAACAAGATAGATTGCGTGCTACCTCTAGAAG
CGGCCGCGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGGATTTTTTTTATCTGAAATTCTGCCTCGTGATACGCCTAT
TTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGNNNTTTTNNGGGAAATGNGCGCNGAANCNCT
ANTTNNTNNTTTTNCTAAATNNNTNNAANANGNNNCCGNTCNNGANNNANTANCNGATAATGCTCANNNNNNTNNNAANG
NANANNNNGANNTNANNNTNCNNNNNNCCNTNNNNNTTTNNNNNNNTTNNNNNNTNNNNNNCCNNNACNNNGGGNAANNN
NANNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNATNN
  • Fos1 with VF2

Sequencing problem

NNNNNNNNNNNTTACCTATANNATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGA
TGATTTCTGGAATTCGCGGCCGCTTCTAGAGGTACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTC
TGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTACAGTTCCTCCTGGCGCCTCATATAGGNNCTC
GNNNCTACCNCCCNCTTCAGCATGANATGANCNGTCANTTTTTTTGTTTTTTTTTTTTTTTTTTTTTTTTTTNANNNTTT
TANCTTCACTCTNGGGCTTTCTTCNTTTTCNTCACAGTTNNNNTGNNTCNGNGGGGACATTTGGCTGCTGCGANNNATAC
CATNTNACTTGGANNCCGTTNANCATGTATCTAN
  • JunB3 with VF2

No significant similarity

NNNNNNNNTNACCNNTNANAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATG
ATTTCTGGAATTCGCGGGACTCGGCATGAACATGTTCGAACAGCAGCAGTGACGTGGTGCGCCCGCGGTCAAACACTTCG
CACCATTCGGCCTGTTTATCCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAA
AAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAG
CTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAA
AAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCG
ACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCT
CTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCA
CGCTGTAGGTATCTCATTTCGGGTGTAGGTCGTTCGCTCCAGCTGGGGCTGTGTGCACAACCCCCCCGTTCAGNCCNACC
GCTGCTNCCTTATCCGGNAANTATCANNTGAATCCAACNN
  • GCN42 with VF2

No significant similarity

NNNNNNNNNNNTNNNNTATNNNNATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGG
ATGATTTCTGGAATTCGCGGGACTCGGCATGAACATGTTCGAACAGCAGCAGTGACGTGGTGCGCCCGCGGTCAAACACT
TCGCACCATTCGGCCTGTTTATCCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACC
GAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTAT
CAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAG
CAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAA
TCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGC
GCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGC
TCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGA
CCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGNAAGACACGACTTATCGCCACTGGCAGCAGCCACTG
GNNACAGGATTAGCAGANCNAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGTNGGCCCTAACTNCNGCTACNCTAG
ANAACANNATTGNTATCTGCGCTCCTGCTGANNCNNNTACCTTTNNNAAAAATANTTGNNNNCTCCTGNTCCGNNAANNN
Personal tools