User:Nader A. Khamis/Notebook/Experimental Biological Chemistry AU Fall 2011/2011/10/12

Project name

Main project page Previous entry      Next entry

Objective Create another Four Point probe. First trial on October 11th failed. The four point probe was chosen over the two point probe because it's more accurate in terms of determining conductivity. Determine if Green Fluorescent Protein (GFP) mutation was successful using the DNA sequence obtained. Description A small Teflon paper was prepared. Four short palladium foils were prepared with the following dimensions: (4.8mm by 6.3mm), Area= 30.24mm2 (2.3mm by 7.4mm), Area= 17.02mm2 (2.2mm by 7.4mm), Area= 16.28mm2 (3mm by 7.5mm), Area= 22.5mm2 Following the preparation: Each palladium wire was glued to a palladium foil using CircuitWorks® 5 Minute Conductive Epoxy. The foil was glued to the teflon. A heat gun was used to accelerate the drying of the glue. Data The conjugated gold nanoparticles fibers prepared from the previous experiment were pipetted onto the four point probe. The concentration of the fiber was insufficient to run the conductivity test. The DNA Sequence (ATG)CGGGGTTCT(CATCATCATCATCATCAT)GGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTC(GGGATCTGTACGACGATGACGATAAG)(GAT) (Start Codon) - (Histidine Tag) - (Enterokinase Cleavage) - (Target Codon) The target codon, GAT, remained the same, indicating that mutation was not successful. Notes This area is for any observations or conclusions that you would like to note. Use categories like tags. Change the "Course" category to the one corresponding to your course. The "Miscellaneous" tag can be used for particular experiments, as instructed by your professor. Please be sure to change or delete this tag as required so that the categories remain well organized. .