User:Pedro Matos/Notebook/Aulas Biologia Molecular 2010/2010/03/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Next entry

Exercício TP1

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

  • Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?

Moléculas de DNA e de RNA. As de DNA possuem o nucleótido T e o açúcar é uma desoxirribose enquanto as de RNA possuem U o açúcar é uma ribose.

  • Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.

Representação de complementariedade, isto é, com a cadeia anti-paralela e indicado as extremidades 3'-5'

  • Poderá esta sequência conter um gene? Justifique a sua resposta.

Poderá conter um gene, caso haja um quadro de leitura, com um codão de iniciação (ATG) e um de STOP, e informação entre estes dois ser de mais de 30 aminoácidos entre eles, para que possamos dizer que é uma proteína.

  • Indique o resultado da transcrição desta sequência.

AACTGTGATGGCTCCACATGATAAAAATGGGCTCAGCGATTAAAAACGGCGTTCCACGATTCGGCGCTC CTTTCGCTCCGACTTGTCCGTCAGCGGGCAGGTGTCCACTGCCACTAGGGCGCACTCGTCGTACGATAA AGGGCGTTTCTATAGTCACTTTTACGGGACTTCCATTACATGTCCGAGTTATTTCGCCCTATGCTTCGGACC

  • É possível prever que proteína se encontra codificada numa sequência nucleotídica?

Como? É possível prever se há alguma proteína codificada por esta sequência, para isto basta assumir que cada três nucleótidos codificam um aminoácido, usando depois um código de tradução.

  • A sequência apresentada codifica alguma proteína?

5'3' Frame 1 L T L P R C T I F T R V A N F C R K V L S R E E S E A E Q A V A R P Q V T V I P R E Q H A I S R K D I S E N A L K V Met Y R L N K A G Y E A W

5'3' Frame 2 Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P

5'3' Frame 3 D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L

3'5' Frame 1 P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q

3'5' Frame 2 Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V

3'5' Frame 3 R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S

Sabendo que estes são as possíveis sequências de aminoácidos resultantes da tradução da sequência em cima, aquelas que poderemos considerar como possíveis proteínas sao as sequências de 5'3' do frame 1 se supusermos que existe um codão de iniciação a montante, a sequência 3'5' do mesmo frame e a sequência 3'5' do frame 2 usando a mesma suposição que da sequência 5'3' do frame 1.

  • Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?

Apesar de haver variações no código genético das bactérias, em ralação ao standard, usando programas bioinformáticos de tradução de sequências de proteínas não encontrei nenhuma diferença na sequência final de aminoácidos.

  • Como poderia saber de que organismo provém esta sequência?

Recorrendo a programas bioinformáticos tais como os BLAST, que analisando a sequência dada iriam comparar com sequências existentes em bases de dado e o resultado seria as probabilidades da sequência pertencer a determinado organismo.

Personal tools