User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/07/10

From OpenWetWare

Jump to: navigation, search
PHIX174 Cell Free Expression Main project page
Previous entry      Next entry

Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.

  • Ligation of the following SphI-PX-NheI linkers into pBEST-SphI//NheI-UTR1-deGFP-T500 ...
    1. SphI-PB-NheI
    2. SphI-PD-NheI
    3. SphI-PF-NheI
    4. SphI-PG-NheI
    5. SphI-PL-NheI
    6. SphI-PL-L-PA-NheI
    7. -linker control

Characterization C: Expression of PHIX174 promoters fused to UTRX-deGFP.

  • Ligation of the following SphI-PX-UTRX-NcoI linkers into pBEST-SphI//NcoI-deGFP-T500 ...
    1. SphI-PB-UTRB-NcoI
    2. SphI-PD-UTRD-NcoI
    3. SphI-PF-UTRF-NcoI
    4. SphI-PG-UTRG-NcoI
    5. SphI-PL-UTRL-NcoI
    6. -linker control

Hypothesis 2: Gene L is necessary for phage propagation.

  • Problem with whole plasmid PCR is my primers.
  • Primers amplified pWhitescript without any problem. Characterizing these using NEB Tm Calculator:
    • Sense primer: CCATGATTACGCCAAGCGCGCAATTAACCCTCAC, annealing T 64 °C, melting T 69 °C
    • Antisense primer: GTGAGGGTTAATTGCGCGCTTGGCGTAATCATGG, annealing T 64 °C, melting T 69 °C
  • On the other hand, my primers for ΦX174 give:
    • ΦX174 sense primer: GATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC, annealing T 57 °C, melting T 63 °C
    • ΦX174 antisense primer: CTATAAAAAGTACCATAACTATTTCGACAACGGCTATGAACCTTG, annealing T 57 °C, melting T 62 °C
  • WAIT! Antisense primer appears to be completely wrong, as it should the reverse compliment of the sense primer! Primers need to be reordered...
    • primer 1:
      1. GATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC, Tm = 63 °C, annealing T = 58 °C
      2. GTTCCAAGTATCGGCAACAGCTTTATCAATACCATGAAAAATATC, Tm = 63 °C
    • primer 2:
      1. GGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGG, Tm = 69 °C, annealing T = 64 °C
      2. CCAGAAATTGTTCCAAGTATCGGCAACAGCTTTATCAATACCATGAAAAATATCAACCACACC, Tm = 69 °C
    • primer 3:
      1. GCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGG, Tm = °C, annealing T = °C
      2. CCGTCTTTCCAGAAATTGTTCCAAGTATCGGCAACAGCTTTATCAATACCATGAAAAATATCAACCACACCAGAAGC, Tm = °C
  • I ordered these primers from BMGC.



Personal tools