User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/07/20

From OpenWetWare

Jump to: navigation, search
PHIX174 Cell Free Expression Main project page
Previous entry      Next entry

Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.

  • Continuing with minicultures and sequencing of the transformants specified on 07/11/2012.

Characterization C: Expression of PHIX174 promoters fused to UTRX-deGFP.

  • Continuing with minicultures and sequencing of the transformants specified on 07/11/2012.

Hypothesis 2: Gene L is necessary for phage propagation.

  • On hold until new primers arrive.

Hypothesis 3: Gene L codes for a ~6 kDA protein.

  • Experiment 3: Simga28 cascade cell free expression batch mode of +L and -L (no plasmid) followed up by high density SDS page.
  • Constructions in stock:
    • pBEST-Ptar-UTR1-L-T500 (110 nM)
  • Constructions needing amplification:
    • pBEST-OR1OR2Pr-UTR1-simga28-T500
    • Transformed. Mark will amplify in the coming weeks.
  • Constructions needing to be made:
    • pBEST-Ptar-UTR1-L-deGFP-T500
    • New constructions: pBEST-Ptar-UTR1-COIL1-T500, pBEST-Ptar-UTR1-COIL2-T500,
  • Vincent gave me the following linkers (coils) for making translational fusions: TCCGGACTCAGATCTCGAGCT (1), (2)GGGCCCTCCGGACTCAGATCTCGAGCT
    • The problem with them is that they have an XhoI site that ends two bp from the end, so if it is used with XhoI sites common in our constructions, the second peptide will be translated out of frame.
    • Therefore I modified these by replacing XhoI with SphI (since SphI is absent from common constructs), adding NcoI to the fore, and BamHI and XhoI to the after.
    • The final structure is NcoI-AccIII-...-SphI...-BamHI-XhoI. Now, when these coils are inserted into pBEST-Ptar-UTR1-NcoI_XhoI-T500. Now, the first polypeptide of a translational fusion can be inserted between NcoI//AccII and the second between BamHI//XhoI. Finally, SphI can be used to verify construction by recutting.
    • Ordered from BMGC.
  • Need to design primers to insert L and deGFP into pBEST-Ptar-UTR1-COIL1-T500 to make pBEST-Ptar-UTR1-L-COIL1-deGFP-T500.

Hypothesis 4: Gene L complexes with cell membrane.

  • Experiment 4: Simga28 cascade cell free expression in vesicles of L-deGFP and L. Followup with in vivo expression in cells observed by microscope (use PT7 promoter on pIvex2.3d).
  • Constructions in stock:
    • pBEST-Ptar-UTR1-L-eGFP (109 nM)
  • Constructions needing amplification:
    • pBEST-OR1OR2Pr-UTR1-simga28-T500 (Mark)
    • pIvex2.3d-deGFP (Mark)
  • Constructions needing to be made or obtained:
    • pIvex2.3d-L
    • pIvex2.3d-L-deGFP
  • Result: Preliminary results show binding of L-eGFP fusion to vesicle membrane.

Personal tools