User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/08/17

From OpenWetWare

Jump to: navigation, search
PHIX174 Cell Free Expression Main project page
Previous entry      Next entry

Hypothesis 2: Gene L is necessary for phage propagation.

  • It's been a battle to get whole plasmid PCR working to amplify ΦX174, the real first step necessary for testing Hypothesis 2. Unrecorded in my notes are a few failed attempts at amplification in the past few weeks. Last month, I saw some very non-specific amplification. To get it right, I returned to the drawing board.
  • I obtained PfuUltra II Fusion HS DNA Polymerase (Stratagene 600670). This is the best DNAP out there for long PCR, including whole plasmid PCR.
  • I performed PCR using PfuUltra II on Stratagene's test plasmid and primers
    • template = 5ng/μL pWhitescript 4.5 kb plasmid
    • forward primer = 100 ng/μL 5´ CCA TGA TTA CGC CAA GCG CGC AAT TAA CCC TCA C 3´, Tm = 69 °C
    • reverse primer = 100 bg/μL 5´ GTG AGG GTT AAT TGC GCG CTT GGC GTA ATC ATG G 3´, Tm = 69 °C
  • PCR protocol followed from the PfuUltra II Fusion manual. The 50 μL reaction components were:
    1. 34.75 μL H2O
    2. 5 μL 10X reaction buffer
    3. 6.25 μL 2mM dNTPs (each) (0.25mM each final)
    4. 1 μL template (0.1ng/μL final)
    5. 1 μL forward primer (2ng/μL final)
    6. 1 μL reverse primer (2ng/μL final)
    7. 1 μL PfuUltra II fusion HS DNA polymerase
  • Leaving out the template, I divided the reaction in half. One half I made the control reaction by adding 0.5 μL H2O (-template) and the other half I made the experimental reaction by adding 0.5 μL 5ng/μL template (0.1ng/μL final).
  • I then performed PCR cycling on our PTC-100 according to what the manual said were optimized conditions for ≤10 kb vector DNA. The cycling program was:
    1. 95 °C 2 min
    2. 95 °C 20 s
    3. Primer Tm - 5 °C (I used 65 °C) 20 s
    4. 72 °C 75 s
    5. Repeat 2-4 an additional 29 times = 30 cycles of PCR
    6. 72 °C 3 min
    7. 12 °C hold
  • I then quantified the two samples, obtaining replicate readings for each sample that varied by 1% (-template) and 0.08% (+template). After averaging and converting the ng/μL using a standard curve, I measured the following:
    • -template sample = 8.6 ng/μL
    • +template sample = 32.7 ng/μL
  • I used the -template sample to estimate the background DNA signal (template + primers). Therefore, the concentration of amplified vector DNA was:
    • 24.1 ng/μL
  • Since the original template concentration was 0.1 ng/μL, the fold change of the amplification process was:
    • 241X (after 30 cycles PCR)
  • Converting concentrations, 24.1 ng/μL of 4.5 kb pWhitescript vector DNA yields:
    • 8.4 nM amplified vector DNA
  • I next checked 5 μL PCR product by gel electrophoresis. I observed the following:
    • -template sample = no band
    • +template same =
  • Therefore, I concluded that I had successfully amplified the pWhitescript vector by whole plasmid PCR. I think perhaps my main problem has been using incorrect annealing temperatures, since I've been setting annealing temperature the same (55 °C) for primers with vastly different Tm's. I think I may have been running many suboptimal reactions with non-specific amplification. The correction I needed to make was getting the annealing temperature right for each reaction.
  • The next step was to do the same thing with ΦX174 using the four different primer sets I've designed to get ΦX174 amplified 33-mer 5'-phosphorylated primers.
    • ΦX174 S 1 = GATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC, 45-mer, Tm = 63 °C, Ta = 58 °C
    • ΦX174 AS 1 = GTTCCAAGTATCGGCAACAGCTTTATCAATACCATGAAAAATATC
    • ΦX174 S 2 = GGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGG, 63-mer, Tm = 68 °C, Ta = 63 °C
    • ΦX174 AS 2 = CCAGAAATTGTTCCAAGTATCGGCAACAGCTTTATCAATACCATGAAAAATATCAACCACACC
    • ΦX174 S 3 = GATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC, 77-mer, Tm = 71°C, , Ta = 66 °C
    • ΦX174 AS 3 = GTTCCAAGTATCGGCAACAGCTTTATCAATACCATGAAAAATATC
    • ΦX174 4 S = CATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC, Tm = 63 °C, , Ta = 58 °C
    • ΦX174 4 AS = GTTCCAAGTATCGGCAACAGCTTTATCAATACCATG,
  • I then setup a 60 μL + 10% whole PCR reaction to test the 45-mer primer pair 1 and teh 33-mer primer pair 2, since they had the same 58 °C annealing temperature.
    1. 45.87 μL H2O
    2. 6.6 μL 10X reaction buffer
    3. 8.25 μL 2mM dNTPs (each) (0.25mM each final)
    4. 1.32 μL template (0.1nM final)
    5. 2.64 μL 5 μM each forward/reverse primer mix (200nM each final)
    6. 1.32 μL PfuUltra II fusion HS DNA polymerase
  • I divided the reaction 4×14.1 μL and then made the following 15 μL reactions
    1. -template, primer 1 (0.3 μL water, 0.6 μL primer 1 mix of 5 μM each S and AS primer 1)
    2. +template, primer 1 (0.3 μL water, 0.6 μL primer 1 mix of 5 μM each S and AS primer 1)
    3. -template, primer 4 (0.3 μL water, 0.6 μL primer 4 mix of 5 μM each S and AS primer 4)
    4. +template, primer 4 (0.3 μL water, 0.6 μL primer 4 mix of 5 μM each S and AS primer 4)
  • I then performed whole plasmid PCR with the following cycling parameters:
    1. 95 °C 2 min
    2. 95 °C 20 s
    3. 58 °C 20 s
    4. 72 °C 75 s
    5. Repeat 2-4 an additional 29 times = 30 cycles of PCR
    6. 72 °C 3 min
    7. 12 °C hold
Personal tools