User:Tanguy Chau/Notebook/Research/2008/07/10

Project name

Main project page

Ligation of R797, R796 into T7 415-1b Vector Inserts obtained from Tim Lu R797: EcorI-Cecropin-HindIII @ 27.9ng/ul Apporoximate size/sequence: GAATTC|STOP|AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG|ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCC|SWLSKTAKKLENSAKKRISEGIAIAIQGGPR|GGATCCGGCTGCTAACAAAGCCCGAAGCTT ~242bp , with ~660g/mol.bp  ~160,000 g/mol For 0.06pmol of insert, need 9.6 ng of insert Need 0.344 ul of R797 insert R796: EcoRI-Indolicidin-HindIII @ 15.1ng/ul Apporoximate size/sequence: GAATTC|STOP|AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG|ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCC|ATTCTGCCGTGGAAATGGCCGTGGTGGCCGTGGCGCCGCTGA|GGATCCGGCTGCTAACAAAGCCCGAAGCTT ~253bp , with ~660g/mol.bp  ~160,000 g/mol For 0.06pmol of insert, need 9.6 ng of insert Need 0.635 ul of R797 insert Ligation Reaction 5 μl Total volume: 1 ul insert (0.02–0.06 pmol) or Positive Control Insert or no insert negative control 1 ul T7Select Vector Arms (0.5 μg; 0.02 pmol) 1.5 ul 10X T4 DNA Ligase Reaction Buffer 10mM ATP 100mMDTT 0.5 ul Sterile water Hold at 55C for 10 min 1 μl T4 DNA Ligase (0.4–0.6 Weiss units) Ligate at 16C for 3-16h