Primers for recT gene
- gtttcttcgaattcgcggccgcttctagatgaataataaaattgaattaatattaaataattc,recT-F
- gtttcttctactagtagcggccgctgcagttattaatcagaaaacatttcattaacagc,recT-R
- gaaatgcaagaagcctatcaacatgaccaagcaataattattaataacagc,recT-mut-F
- gctgttattaataattattgcttggtcatgttgataggcttcttgcatttc,recT-mut-R
Vector NTI file for recT mutated gene
- from S. citri protein CAK99381
- mutated to eliminate GATC site
- biobricked, entered as part J70007 [[1]]
- media:recT-SC.gb
Transformations
- transform E. coli at 2.0 KV outgrow in 1 ml SOC rotated
- plate out 100 μl at 1 hour/2.5 hour/3.5 hour
- transform M. florum frozen cells
- T1, perhaps sparked at 2.0 KV; outgrew anyway
- T2, transformed at 2.0 KV without sparking
- plated out 290 μl at 1 hour and 2 hour and 3 hour
- Added 1 ul Tet to 300 ul culture at 2 hours for T1 and 1 hour for T2
- Plated out both tet and non-tet added cultures for T1 and T2
Made electrocompetent cells
- 5 ml and 500 ul seed culture tubes (50 ml final) grown 18 hours at 30C
- Spin down, resuspend in 45 ml EPB
- again
- again, in 20 ml
- spin down, resuspend in remaining liquid, bring to 250 ul
- add 35 ul 80% glycerol
- Aliquot to 50 ul tubes
- flash freeze in EtOH + dry ice
|