User:Tk/Notebook/MF/2008/07/28

From OpenWetWare

Jump to: navigation, search
Mesoplasma florum simplification Main Page
Previous entry      Next entry

Resequencing of problematic Me. florum regions

  • Primers for PCR and sequencing


  • ttaggttttcacttaccaagaaaagg,F0050, 532951R
  • actacagctatttcgtcagttaaagtaa,F01063, 531938R
  • aacggaattaacgaaaagttagca,R01280, 531731F
  • ggattttcttttagtaatagttgcagc,F02050, 530951R
  • cattaaccataaataccaacattcca,R02227, 530774F
  • taaagatggcaagtagaattaccaaa,F03226, 529775R
  • cctagtcctgaattacatccaaa,R03296, 529705F
  • gagctagtggagtttatagttcagaatc,F04220, 528781R
  • gcacgatataggttttttcacttc,R04281, 528720F
  • cagtctctgaaagagctaaaattga,F05200, 527801R
  • ctttttcaatcgcaatgcttc,R05304, 527697F
  • aggagaagtggaatgagataagga,F06212, 526789R
  • aattcgccatcaaattctga,R06307, 526694F
  • gcatgagatacatcaaaagtaactga,F7152, 525291R
  • gctgaagcatcagaaaacatact,R07282, 525719F
  • ttgactatctcaaagtatagattagtgttttt,F08163, 524838R
  • tatctgataaaatacctaaacctagaattaac,R08268, 524733F
  • atataacccattttgagataaaatgattg,F09100, 523901R
  • acgtaaaaagaaaggaattataaatttga,R09225, 523776F
  • tagtggttgttacattaacaacaaacg,F10092, 522909R
  • cttccaattttgattgcaaga,R10199, 522802F
  • gatgaagcacataaaaatcaagc,F11042, 521929R (several other matches)
  • agttgaatcatcttcagtaacatcaaa,R11146, 521855F
  • tcagctgctaaaggaaatgatg,F12017, 518806R
  • ttaacagttgaaacatcatttccttt,R12141, 518772F
  • gatttagcagatattattaaagctgatga,F13112, 518845R (dozen other matches to 521193, every 261 bp)
  • ccagctgcagttaacacagttt,R13218, 518739F (dozen other matches to 521xxx)
  • ttgttgatggttctaaagtaacttttg,F14100, 518640R (dozen other matches)
  • cagttgaaacatcatttcctttagc,R14225, 518776F (half dozen other matches)
  • ctgatgaaaacataatgtttgaattaa,F15090, 517911R
  • ttacctcttttctaacttcatattgttatt,R15314, 517687F
  • tcgtgtagttagataccaccctaaga,F16076, 516925R
  • cttttgtatatggttgtctgtgacc,R16146, 516855F
  • gagcgtctggtgaatcaatc,R16977, 516024F





Personal tools