User:Tk/Notebook/MF/2008/07/31

From OpenWetWare

Jump to: navigation, search
Mesoplasma florum simplification Main Page
Previous entry      Next entry

Transposon insertion event at 523000-525000

A pseudogene and inactive IS3/IS1138 transposon is at 523336-524543

  • IRL: 523336-523356
  • IRR: 524523-524543
  • The sequence of the transposon insertion site is: ataaactgggaaaaataaaat / ataaactgggaaaaaataaat
  • Compare to the IS1138 transposon end sequences: taaactgggacaaaaaaat / taaactaggacaaaaaaact


  • Transposase gene has three frame shifts and multiple stop codons (both TAA and TAG)
  • Approximate locations:
    • 523660-524485
    • Frame 1: 523660-523993
    • Frame 3: 523969-524161
    • Frame 2: 524170-524260
    • Frame 3: 524275-524485


  • There may be a six bp repeat outside of the IRL/IRR boundary:
    • taagca on the left
    • gatgca on the right


  • Tn5 transposon insertion events captured:
    • TT01-3111_TT01-.seq 524040 fwd
    • TT01-3233_TT01-.seq 524201 rev
    • TT01-2677_TT01-.seq 524358 fwd
    • TT01-3383_TT01-.seq 524358 fwd




Personal tools