User:Tk/Notebook/MF/2008/10/28

From OpenWetWare

Jump to: navigation, search
Mesoplasma florum simplification Main Page
Previous entry      Next entry

Biobrick MF components

Plasmid backbones

  • Prefix-RB
  • Suffix-FB
  • templates: pSB1AC3, pSB1AK3, pSB1AT3

J70007, recT gene coding region

gtttcttcgaattcgcggccgcttctagatgaataataaaattgaattaatattaaataattc,recT-F
gtttcttctactagtagcggccgctgcagttattaatcagaaaacatttcattaacagc,recT-R
gaaatgcaagaagcctatcaacatgaccaagcaataattattaataacagc,recT-mut-F
gctgttattaataattattgcttggtcatgttgataggcttcttgcatttc,recT-mut-R 


Template: Spiroplasma citri genomic DNA (Renaudin)

858 bp

J70023, MF plasmid origin

GTTTCTTCGAATTCGCGGCCGCTTCTAGAGgccctacttgtttagatagtttaattc,J00023-F
GTTTCTTCCTGCAGCGGCCGCTACTAGTAttgggagtgcggggtttggggtgc,J00023-R
GTTTCTTCGAATTCGCGGCCGCTTCTAGAGtaattataaaaacaccttattttac,J00023-F2

Template: Spiroplasma citri genomic DNA (Renaudin)

1878 bp

J70024, tetM gene coding region

GTTTCTTCGAATTCGCGGCCGCTtctagatgaaaatcataaatatcgg,J00024-F
GTTTCTTCCTGCAGCGGCCGCTactagtattattatgtgattttgttg,J00024-R

Template: pTT01 plasmid DNA

1920 bp

J70025, tetM promoter region (pBOT1)

GTTTCTTCGAATTCGCGGCCGCTTCTAGAGggccagtctacatgtactc,J00025-F
GTTTCTTCCTGCAGCGGCCGCTACTAGTAttcctccattcaaaaacccaa,J00025-R 

Template: pTT01

345 bp long

J70026, cat resistance cassette

GTTTCTTCGAATTCGCGGCCGCTTCTAGAGaatagttacccttattatcaag,J70026-F
GTTTCTTCCTGCAGCGGCCGCTACTAGTAtctggagctgtaatataaaaacc,J70026-R 

Template: pKV104 plasmid (Krause)

1030 bp

PCR results

  • E-Gel 0.8%
  • bands:
    • marker
    • pSB1AC3
    • pSB1AK3
    • pSB1AT3
    • J70023
    • J70023
    • J70024
    • marker
    • J70025
    • J70026
    • J70007
    • marker

image:tk2.png


Re-do plasmid PCRs with a higher annealing temperature

PCR purify J70023, 23-F2, 24, 25, 26


Personal tools