Project Description/Abstract
Multiple-mutation reaction
- Note: To make things easier I will use the abbriviation MMR for Multiple-mutation reaction from now on.
- With the MMR one can introduce many mutations in one step which is for example nice to change codons in genes from organisms that use a stop codon to code for an amino acid. If you want to express such a gene in E. coli you'll have a problem. For detail see the original paper [1].
- The basic priciple is that you have mutagenic primers with a high melting temperature and flanking primers with a lower melting temperature. If the template is than amplified by PCR the elongation can only procced if it builds in the mutagenic primers. The mutagenic primers are phosphorylated at their 5′ ends, and these are ligated to the 3′ OH groups of the extended upstream primers by the action of a thermostable DNA ligase.
- If one has everything one needs it's actually not much more than a PCR (In my experience such "simple cloning" is the worst).
Rational of my experiment
- I want to introduce silent mutations to generate six additional GATC-sites in the coding region of gfp. GATC-sites are substrate for the E. coli Dam-Methylase and the sequestration protein SeqA binds there. I'm interested in the effect of SeqA binding on transcription and translation. By analysing the reporter GFP after introducing 6 new GATCs in comparison with the one with only three, I hope to get an idea if SeqA has an influence on transcription/translation. The further experiments could be done in vivo and in vitro.
Experimental setup
- I was searching the literature for a plasmid with gfp under control of pBAD which is an arabinose inducible promoter. With the pBAD will be possible to switch on and of transcription which is nice if you want to analyze effects on transcription and translation. I was lucky to find a pBAD-gfp described by Joel Hoskins and colleagues [2]. Joel was so nice to send me the corresponding strain so that I have now a template for the PCR and a reference.
- Next thing I did was to get the sequence of pBAD-gfp in VectorNTI and select sites to be mutated:
- In dark red the sites are marked that can be changed with one silent mutation to GATC and in light red the sites that need two silent mutations.
- The DpnI cut-sites present GATC-sites that are allready in the gfp coding region.
- In green I marked the flanking primers that are a bit outside to allow cutting of the generated PCR-fragment prior to cloning with EcoRI and XbaI or PstI or HindIII.
- The yellow nucleotides mark the primer sequences. Since some mutation sites are located very close I choose to use both reverse and forward primers. This should work as suggested by Hames et al. [1].
Primer
- Here are the primers that I ordered:
| GFPrv ctgatttaatctgtatcaggc (Tm 55)
|
| GFPfw ctctctactgtttctccatac (Tm 57)
|
| GFPmut1fw caaacaaaagaatggGatcaaagctaac (Tm 62 without modified nucleotide)
|
| GFPmut2rv caatgttgtggcgGatCttgaagttag (ctaacttcaaGatCcgccacaacattg) (Tm 63 without modified nucleotide)
|
| GFPmut3fw caactagcagaTcattatcaacaaaatac (Tm 63 without modified nucleotide)
|
| GFPmut4rv gccatcgccGatCggagtattttg (caaaatactccGatCggcgatggc) (Tm 62 without modified nucleotide)
|
| GFPmut5fw cgaaaagcgtgaTcacatggtcc (Tm 64 without modified nucleotide)
|
| GFPmut6fw ctgctgctgggatCacacatggc (Tm 66 without modified nucleotide)
|
- CGATCG, which is cut by PvuI (cuts nowhere else in gfpuv but in the pBAD-gfp vector)
- TGATCA, which is cut by BclI (cuts nowhere else in gfpuv or vector)
→This introduced restriction sites are nice for a first analysis of the mutated plasmid candidates. If they cut it is a proof that the mutations (at least at this sites) are right.
Buffer
- Combining two enzymes (Pfu and Taq ligase) raises the question if one should use one of the supplied buffers or make one new.
- Hames et al used "MMR buffer" (20 mM Tris-HCl [pH 8.5], 3 mM MgCl2, 50 mM KCl, 0.4 mg/ml bovine serum albumin, and 0.5 mM NAD+)[1]
- The NAD+ is needed as cofactor for the Taq ligase which is supplied with its own buffer (1X Taq DNA Ligase Reaction Buffer: 20 mM Tris-HCl, 25 mM potassium acetate, 10 mM Magnesium Acetate, 1 mM NAD, 10 mM Dithiothreitol, 0.1 % Triton X-100, pH 7.6 @ 25°C)(NEB.
- The Pfu is provided with another buffer (Pfu DNA Polymerase 10X Reaction Buffer with MgSO4 (M776A): 200mM Tris-HCl (pH 8.8 at 25°C), 100mM KCl, 100mM (NH4)2SO4, 20mM MgSO4, 1.0% Triton® X-100 and 1mg/ml nuclease-free BSA)
→What I will try is to use the Taq ligase buffer in a first shot. Running a control PCR with only the flanking primers should allow to judge if the PCR itself worked properly.
PCR Program
- Hames et al used: "denaturation at 95°C for 30 s, primer annealing at 57°C for 30 s, and elongation at 65°C for 6 min, for 35 cycles. Initially, the DNA fragment (100 ng) was denatured for 5 min at 95°C." [1]
- The time for the elongation is probably set to a quite long time because the ligation needs some time. Usually less than 2 min should be sufficient for a 1500 bp fragment (in the Hames study). However, since the gfpuv is smaler I reduce the elongation time to 5 min and keep the other times and temperatures.
Future Plans
- insert gfp into chromosome and analyse
- methylation status
- gfp-expression
- maybe mRNA amount of gfp
- SeqA bound to gfp by ChIP
- compare to plasmid-gfps
- transfere to seqA deletion strain and compare wt and mutated gfp
- analysis in vitro:
- in vitro transcription with and without SeqA
- maybe in vitro translation with and without SeqA
- use different methylated templates
Oligos to delet the three GATCs that are in the GFP coding region:
| GFPmut7fw GTTATCCGGACCATATGAAACGGC (Tm 63 °C without modified nucleotide)
|
| GFPmut8fw CATTGAAGATGGGTCCGTTCAACTAG (Tm 64 °C without modified nucleotide)
|
| GFPmut9fw CCTTTCGAAAGACCCCAACGAAAAG (Tm 64 °C without modified nucleotide)
|
- The mutation by oligo GFPmut8fw deletes a BamHI restriction site! (good for restriction analysis to check if mutagenesis was succesfull)
References
- Hames C, Halbedel S, Schilling O, and Stülke J. . pmid:16000825. PubMed HubMed [Hames-2005]
- Hoskins JR, Singh SK, Maurizi MR, and Wickner S. . pmid:10922051. PubMed HubMed [Hoskins-2000]
All Medline abstracts: PubMed HubMed
Notes
|