User talk:Nkuldell:M13 redesign

From OpenWetWare

Jump to: navigation, search

Contents

M13.1:rough sketch

genetic element promoter RBS coding
start synthesis with
gII BBa_M13102
(need 5' UTR?)
BBa_M13502 BBa_M13002'
(modified to remove gene 10 promoter)
gX BBa_M13110
(need 5' UTR?)
BBa_M13510 BBa_M13010'
(modified to remove gene 5 promoter)
gV BBa_M13105
(need 5' UTR?)
BBa_M13505 BBa_M13005
gVII BBa_M13507 BBa_M13007'
(modified to remove overlap with gene 9 dwnstm)
gIX BBa_M13509 BBa_M15009'
(modified to remove overlap with gene 8 dwnstm)
gVIII BBa_M13108
(need 5' UTR?)
BBa_M13508 BBa_M13008
Transcriptional terminator (if M13K07 part, then need to modify to remove gene 3 promoter)
gIII BBa_M13103 BBa_M13503 BBa_M13003'
(modified to remove gene 6 promoter, change GTG start?)
gVI BBa_M13106 BBa_M13506 BBa_M13006'
(modified to remove gene 1 promoter)
gI BBa_M13101 BBa_M13501 BBa_M13001'
(modified to remove gene 11 RBS, gene 4 promoter, RBS, start)
gXI BBa_M13511 BBa_M13011'
(modified to remove gene 4 promoter, RBS, start)
gIV BBa_M13104
(need 5' UTR?)
BBa_M13504 BBa_M13004'
M13K07 ori/KanR/p15a ori
end synthesis


Note: modified parts codon varied to remove direct repeats.

Coding sequences/replication sequences

genetic element bp in M13K07 [[1]] BBa_ notes on standardization
gene II CDS 8268- 831 BBa_M13002 will need to disable internal RBS that allows gX transcription from within gII coding sequence
gene X CDS 496- 831 BBa_M13010 need to unstuff from inside gII
gene V CDS 843-1106 BBa_M13005 RBS overlaps stop of upstream gII, gX
gene VII CDS 1108-1209 BBa_M13007 stop codon overlaps with start of dwstm gIX
gene IX CDS 1206-1304 BBa_M13009 start codon overlaps with stop of upstm gVII
stop codon overlaps with start of dwstm gVIII
gene VIII CDS 1301-1522 BBa_M13008 start codon overlaps with stop of upstm gIX
might want different BBa with codon varied ORF
might want to include silent cloning sites for N-terminal fusions after first Ala of mature protein
gene III CDS 1579-2853 BBa_M13003 start codon is GTG
RBS is within transcriptional terminator for upstream gVIII
unique BamHI site in domain 2 may be useful for cloning
gene VI CDS 2856-3194 BBa_M13006
gene I CDS 3196-4242 BBa_M13001 will need to disable internal RBS that leads to gXI transcription

weach rho-dependent terminator limits gI txn
rare codons limit gI tln

gene XI CDS 3916-4242 BBa_M13011 need to unstuff from inside gI
gene IV CDS 4220-5500 BBa_M13004 start codon and RBS are within gI/gXI coding sequence
stop codon is within M13 ori on M13K07
M13 origin of replication (portion) 5488-5830
p15A origin of replication (counterclockwise) 6591-6046
Tn903 kanamycin resistance CDS 7956-7141
M13 origin of replication (portion) 8093-8130

RBS as identified in Gene (1980) 11:129-148

Renumbered bp according to M13K07 genome annotation
16S RNA 3'OHAUUCCUCCACUAG--------
Note: All RBS are directly followed by ATG of coding seq then a codon starting with A, except gene 6, gene 7 and gene I which follow ATG with G (genes 1 and 7) or C (gene 6). Genes 1, 6 and 7 are translated only to low levels in vivo and in vitro.

genetic element bp in M13K07 [[2]] BBa_ seq
gene II RBS 8252-8267 BBa_M13502 ATCAACCGGGGTACAT
gene X RBS 480-495 BBa_M13510 ATTTGAGGGGGATTCA
gene V RBS 827-842 BBa_M13505 CATAAGGTAATTCACA
gene VII RBS 1092-1107 BBa_M13507 GTTCCGGCTAAGTAAC
gene IX RBS 1190-1205 BBa_M13509 TCGCTGGGGGTCAAAG
gene VIII RBS 1285-1300 BBa_M13508 TAATGGAAACTTCCTC
gene III RBS 1563-1578 BBa_M13503 TTTGGAGA TTTTCAAC
gene VI RBS 2840-2855 BBa_M13506 ATAAGGAGTCTTAATC
gene I RBS 3180-3195 BBa_M13501 GATTGGGATAAATAAT
gene XI RBS 3900-3915 BBa_M13511 AATTTAGGTCAGAAG
RBS not identified in Gene 1980 paper
gene IV RBS 4204-4219 BBa_M13504 AAAAAAGGTAATTCAA

Promoters as identified in Gene (1980) 11:129-148

Renumbered bp according to M13K07 genome annotation
-10 is TATAATpu centered around -8 from mRNA initiation point
-35 is TGTTGACAATT centered around -35 from mRNA initiation point
+2 position is often T
Many of these promoters were identified as DNA fragments that could bind RNAP

genetic element bp in M13K07
[[3]]
BBa_ seq
matches to -35 and -10 concensus in bold
positions -30, -20, -10 and zero relative to mRNA start in red
differences with fd in purple
gene II promoter 8188-8235 BBa_M13102 TATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTT
gene X promoter 381-428 BBa_M13110 TCTTTTTGAT GCAATCCGCTTTGCTTCTGA CTATAATAGT CAGGGTAA
gene V promoter 786-835 BBa_M13105 CCAACGTCCTGACTGGTATAATGAGCAGTTCTTAAAATCGCATAAGGTA
gene VII promoter driven from II, X, V promoters (BBa_M13102,_M13110,_M13105)?
gene IX promoter driven from II, X, V promoters (BBa_M13102,_M13110,_M13105)?
gene VIII promoter 1155-1201 BBa_M13108 AATCTC CGTTGTACTT TGTTTCGCGC TTGGTATAATCGCTGGGGGT C
gene III promoter 1500-1547 BBa_M13103 AATTCACCTCGAAAGCAAGCTGATAAACCGATACAATTAAAGGCTCCT
gene VI 2716-2764 BBa_M13106 GGTAAACCATATGAATTTTCTATTGATTGTGACAAAATAAACTTATTCC
gene I promoter 3086-3132 BBa_M13101 CCCGTCTAATGCGCT TCCCTGTTTTTATGTTATTCTCTCTGTAAAGG
gene XI promoter protein from translation re-initiation event within gene I transcript
gene IV promoter 4055-4103 BBa_M13104 TTGATAAATTCACTATTGACTCTTCTCAGCGTCTTAATCTAAGCTATCG

Terminator sequences

Intergenic region I between genes VI and II, contains ori and PS
Intergenic region II between genes VIII and III, contains transcription terminator

Personal tools