Van Oudenaarden Lab:C17C3.10

From OpenWetWare

Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>C17C3.10 (spliced + UTR - 966) ATGGACCGCA GAAAGCTTCA AAAAGAGGCA AGAAGTGAAA TGAAAAAGAC CGCCAATGGC GTCGACCGTG CCACATATAA CCGAGCAAAG GCTCTTTTGG AGATAATCCG GAAGGAAGAG ATTGCCACAA ATGATCTGGC TTCCTCCACG ATCTCCAAGA TGCCAAAAGT TATCCCATCT TCAATGAGCG ATTATCGTTC CGTCCCATAC AATCAAACTC CAAAATCAGG ATCTGAACGG AAAAGAAGAA ATATTACAAA CGAGTTGATT AACGAATGCA AGACGATTGT TCAAAAATCA GAAGAAGAAC ATATATCACA AGAAGTAGTT CTCTTCCGAA TTGTGAAACT TGTGACTGGA GTTAATCTGG AATCTAATTT CTCATCGAAT GACCTCTCCG AATCTACAAG ACGGAAGTTT GATACTGAAT CCGAAAGAAG AAAAGTGAAG ACTGAACGTG AAAAGATTCG AAGAAAGAAA CAAGATGACT GTTATGCTGA ATTGAAATTC TTCATTTTGA ACAAACAAAT GGGAAGTTAC GAGCAACGAT TAAAACTTGA ACGGATCACA ATTCTAGAAA TCATCATTGA TTACATTAAA CACAATTCCG ATCTTCTGTA TCCAGAAACA ATTCCCCAAA TACTTCCTCT TTTAGCTGGA AAATCAACTG CTACTTGTGA GAACAAAGAG AATGAAAAGC CAAAAACACG AATGGAAGTG AAGGATCTCT TCCCAAGATT GACGTTTCAA GAAGTTCAAG AATCCCCAAC ATCTACTTCT CCATTGCTCA CATTTCCATG TATTCCAATG ATCCCAACTA CTCAGTTCAA TGTCTTGTCA AACTACAACA CCGTTCCATC AATATTTTCT GCTCCCCTCC GATTCATTCT TCCATCACTT CAAATCTTAA CACCAGAAAC TAGTGACGAG GAAGAAAATG AAGAAACCGT CGATATTAGT AACTAG


Name of probe set: hlh-27 Probes designed on Wed, 03 Mar 10 23:45:39 -0700 40 probes designed for target of length 966

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

ttttgaagctttctgcggtc, hlh-27_1, 1, 4, 45 ggcggtctttttcatttcac, hlh-27_2, 2, 35, 45 ttatatgtggcacggtcgac, hlh-27_3, 3, 61, 50 ctccaaaagagcctttgctc, hlh-27_4, 4, 83, 50 caatctcttccttccggatt, hlh-27_5, 5, 105, 45 gaggaagccagatcatttgt, hlh-27_6, 6, 127, 45 ttttggcatcttggagatcg, hlh-27_7, 7, 149, 45 cgctcattgaagatgggata, hlh-27_8, 8, 171, 45 ttgtatgggacggaacgata, hlh-27_9, 9, 193, 45 cagatcctgattttggagtt, hlh-27_10, 10, 216, 40 gtaatatttcttcttttccg, hlh-27_11, 11, 238, 30 gcattcgttaatcaactcgt, hlh-27_12, 12, 260, 40 ctgatttttgaacaatcgtc, hlh-27_13, 13, 282, 35 cggaagagaactacttcttg, hlh-27_14, 14, 319, 45 ctccagtcacaagtttcaca, hlh-27_15, 15, 342, 45 gaggtcattcgatgagaaat, hlh-27_16, 16, 377, 40 acttccgtcttgtagattcg, hlh-27_17, 17, 399, 45 cttctttcggattcagtatc, hlh-27_18, 18, 421, 40 ttcacgttcagtcttcactt, hlh-27_19, 19, 443, 40 cttgtttctttcttcgaatc, hlh-27_20, 20, 465, 35 ttcaattcagcataacagtc, hlh-27_21, 21, 487, 35 cttcccatttgtttgttcaa, hlh-27_22, 22, 517, 35 caagttttaatcgttgctcg, hlh-27_23, 23, 540, 40 atttctagaattgtgatccg, hlh-27_24, 24, 562, 35 cagaagatcggaattgtgtt, hlh-27_25, 25, 599, 40 tttggggaattgtttctgga, hlh-27_26, 26, 621, 40 tttccagctaaaagaggaag, hlh-27_27, 27, 643, 40 gttctcacaagtagcagttg, hlh-27_28, 28, 665, 45 gtttttggcttttcattctc, hlh-27_29, 29, 688, 35 gagatccttcacttccattc, hlh-27_30, 30, 710, 45 cttgaaacgtcaatcttggg, hlh-27_31, 31, 732, 45 gatgttggggattcttgaac, hlh-27_32, 32, 754, 45 aaatgtgagcaatggagaag, hlh-27_33, 33, 776, 40 gttgggatcattggaataca, hlh-27_34, 34, 799, 40 tgacaagacattgaactgag, hlh-27_35, 35, 821, 40 ttgatggaacggtgttgtag, hlh-27_36, 36, 843, 45 aatcggaggggagcagaaaa, hlh-27_37, 37, 865, 50 gatttgaagtgatggaagaa, hlh-27_38, 38, 887, 35 cgtcactagtttctggtgtt, hlh-27_39, 39, 909, 45 cgacggtttcttcattttct, hlh-27_40, 40, 933, 40


Input sequence with probe locations:


atggaccgcagaaagcttcaaaaagaggcaagaagtgaaatgaaaaagaccgccaatggcgtcgaccgtg

  ctggcgtctttcgaagtttt           cactttactttttctggcgg      cagctggcac
  Probe # 1, 45% GC              Probe # 2, 45% GC         Probe # 3,

ccacatataaccgagcaaaggctcttttggagataatccggaaggaagagattgccacaaatgatctggc ggtgtatatt ctcgtttccgagaaaacctc ttaggccttccttctctaac tgtttactagaccg

50% GC     Probe # 4, 50% GC     Probe # 5, 45% GC     Probe # 6, 45%

ttcctccacgatctccaagatgccaaaagttatcccatcttcaatgagcgattatcgttccgtcccatac aaggag gctagaggttctacggtttt atagggtagaagttactcgc atagcaaggcagggtatg

GC     Probe # 7, 45% GC     Probe # 8, 45% GC     Probe # 9, 45% GC 

aatcaaactccaaaatcaggatctgaacggaaaagaagaaatattacaaacgagttgattaacgaatgca tt ttgaggttttagtcctagac gccttttcttctttataatg tgctcaactaattgcttacg

    Probe # 10, 40% GC    Probe # 11, 30% GC    Probe # 12, 40% GC   

agacgattgttcaaaaatcagaagaagaacatatatcacaagaagtagttctcttccgaattgtgaaact

ctgctaacaagtttttagtc                 gttcttcatcaagagaaggc   acactttga
Probe # 13, 35% GC                   Probe # 14, 45% GC     Probe # 1

tgtgactggagttaatctggaatctaatttctcatcgaatgacctctccgaatctacaagacggaagttt acactgacctc taaagagtagcttactggag gcttagatgttctgccttca 5, 45% GC Probe # 16, 40% GC Probe # 17, 45% GC

gatactgaatccgaaagaagaaaagtgaagactgaacgtgaaaagattcgaagaaagaaacaagatgact ctatgacttaggctttcttc ttcacttctgacttgcactt ctaagcttctttctttgttc ctga Probe # 18, 40% GC Probe # 19, 40% GC Probe # 20, 35% GC Prob

gttatgctgaattgaaattcttcattttgaacaaacaaatgggaagttacgagcaacgattaaaacttga caatacgacttaactt aacttgtttgtttacccttc gctcgttgctaattttgaac e # 21, 35% GC Probe # 22, 35% GC Probe # 23, 40% GC

acggatcacaattctagaaatcatcattgattacattaaacacaattccgatcttctgtatccagaaaca

gcctagtgttaagatcttta                 ttgtgttaaggctagaagac  aggtctttgt
Probe # 24, 35% GC                   Probe # 25, 40% GC    Probe # 26

attccccaaatacttcctcttttagctggaaaatcaactgctacttgtgagaacaaagagaatgaaaagc taaggggttt gaaggagaaaatcgaccttt gttgacgatgaacactcttg ctcttacttttcg , 40% GC Probe # 27, 40% GC Probe # 28, 45% GC Probe # 29, 3

caaaaacacgaatggaagtgaaggatctcttcccaagattgacgtttcaagaagttcaagaatccccaac gtttttg cttaccttcacttcctagag gggttctaactgcaaagttc caagttcttaggggttg 5% GC Probe # 30, 45% GC Probe # 31, 45% GC Probe # 32, 45% G

atctacttctccattgctcacatttccatgtattccaatgatcccaactactcagttcaatgtcttgtca tag gaagaggtaacgagtgtaaa acataaggttactagggttg gagtcaagttacagaacagt C Probe # 33, 40% GC Probe # 34, 40% GC Probe # 35, 40% GC

aactacaacaccgttccatcaatattttctgctcccctccgattcattcttccatcacttcaaatcttaa

 gatgttgtggcaaggtagtt  aaaagacgaggggaggctaa  aagaaggtagtgaagtttag  tt
 Probe # 36, 45% GC    Probe # 37, 50% GC    Probe # 38, 35% GC    Pr

caccagaaactagtgacgaggaagaaaatgaagaaaccgtcgatattagtaactag gtggtctttgatcactgc tcttttacttctttggcagc obe # 39, 45% GC Probe # 40, 40% GC

Personal tools