Van Oudenaarden Lab:Y39A3CR.6

From OpenWetWare

Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>Y39A3CR.6 (spliced + UTR - 1038) ATGTCCGACT CCCCGCAGAG CTGCAAAAAG CCGCGAACTC GGAAAGAAAC TATTCAAAAG CGAGAAACAC GAAGTAAGCA TGAAAAACGA CGAAGGGAAG AGATGAATGA AGTGATTTGT GAAATGTCGA CACTTTTGCC CGAAGATATT CGGGCTCATA AGCTGCGAAG AGTGGATCAG AAGCCTCGTC AGCTGGACAA ATGCTTTATC ATTGGGAGTA CTGTTGATAT TATTCGGAAT AGTGATTATA AACCACCGCT GCTCTCCGAC CCGCTCGTCC AGGATATTTT CAGCCTGACC AACTGTTTTA TGGTTTTTCT GAACAATTTT ATTGTCGTGG ATATTAAGGG AGACCATCAG GCAGTTTTTG ATATTGAAAA AAAACGTATG ATTGGAAAAG ATATCCGATG TTTTCTGGAC TACGATTCAA CGTCCAAACT GTCATTTCTC ACTTCCAAAG AAATGCTCAA TGAGCTCCAA CTCAAAAGCT TCATGGCGAA GTCAATGACG TGCAGAATAA AGGAATCGGC GGAGAAACCC ACGGAAACAG TTTTAGTCTG TGTGCCTGAT GAGCTTCCAG CTCTCCCGGT TACTGTACCC AAGGCTCCGC CCATTTTAGC TTCGCCCCTT CAGAAGACAC CGCCCCCGCC GTCGAGTTTG GAGGTGAAAA GCCCGATTTT GGCGGCACTT TTGAGGCGAA AAGAGGATAA TTGTGTGAAA GTGAGCTCCC CAAGCTCCTT CCTCTCGCCG GGCTCCTCCA CCTCGTCTAC AGTACCCAAT GTGAAACCTA CAGTAACCCG CCGACCTACA GTACCCACAA AACGGAAGAG ACTACGATCG ATGAATGTTA TAGTGGAAAG TTATCCGTTG GATGATGAGA AGTCGGATGG AAATTCACAA AAATCGGCGA AAATTGGGAA AAAGAGGTTT TTTCTAACAA AAAAAAACGT TAAAACCTAC AGTAATCTAC TCCAAAATCC ATGCGAGACC CTTAAAACTG AAAATTTCAA ATTTAGCTCA ACAAGACCTT TCAAATGA


Name of probe set: hlh-33 Probes designed on Wed, 03 Mar 10 23:24:13 -0700 42 probes designed for target of length 1038

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

tttttgcagctctgcgggga, hlh-33_1, 1, 10, 55 tagtttctttccgagttcgc, hlh-33_2, 2, 33, 45 cttcgtgtttctcgcttttg, hlh-33_3, 3, 55, 45 ccttcgtcgtttttcatgct, hlh-33_4, 4, 77, 45 caaatcacttcattcatctc, hlh-33_5, 5, 100, 35 gggcaaaagtgtcgacattt, hlh-33_6, 6, 122, 45 gcttatgagcccgaatatct, hlh-33_7, 7, 144, 45 ggcttctgatccactcttcg, hlh-33_8, 8, 166, 55 aaagcatttgtccagctgac, hlh-33_9, 9, 188, 45 tatcaacagtactcccaatg, hlh-33_10, 10, 210, 40 cagcggtggtttataatcac, hlh-33_11, 11, 242, 45 aaaatatcctggacgagcgg, hlh-33_12, 12, 271, 50 cataaaacagttggtcaggc, hlh-33_13, 13, 293, 45 cccttaatatccacgacaat, hlh-33_14, 14, 331, 40 atcaaaaactgcctgatggt, hlh-33_15, 15, 353, 40 ccaatcatacgttttttttc, hlh-33_16, 16, 376, 30 ccagaaaacatcggatatct, hlh-33_17, 17, 399, 40 agtttggacgttgaatcgta, hlh-33_18, 18, 421, 40 ttctttggaagtgagaaatg, hlh-33_19, 19, 443, 35 tgagttggagctcattgagc, hlh-33_20, 20, 465, 50 attgacttcgccatgaagct, hlh-33_21, 21, 487, 45 cgattcctttattctgcacg, hlh-33_22, 22, 509, 45 ctgtttccgtgggtttctcc, hlh-33_23, 23, 531, 55 tcatcaggcacacagactaa, hlh-33_24, 24, 553, 45 agtaaccgggagagctggaa, hlh-33_25, 25, 575, 55 taaaatgggcggagccttgg, hlh-33_26, 26, 599, 55 gtgtcttctgaaggggcgaa, hlh-33_27, 27, 621, 55 ttttcacctccaaactcgac, hlh-33_28, 28, 651, 45 aaaagtgccgccaaaatcgg, hlh-33_29, 29, 673, 50 acaattatcctcttttcgcc, hlh-33_30, 30, 695, 40 agcttggggagctcactttc, hlh-33_31, 31, 717, 55 ttgggtactgtagacgaggt, hlh-33_32, 32, 760, 50 gcgggttactgtaggtttca, hlh-33_33, 33, 782, 50 gttttgtgggtactgtaggt, hlh-33_34, 34, 804, 45 cattcatcgatcgtagtctc, hlh-33_35, 35, 828, 45 aacggataactttccactat, hlh-33_36, 36, 850, 35 tccatccgacttctcatcat, hlh-33_37, 37, 872, 45 ttttcgccgatttttgtgaa, hlh-33_38, 38, 894, 35 agaaaaaacctctttttccc, hlh-33_39, 39, 916, 35 ggagtagattactgtaggtt, hlh-33_40, 40, 954, 40 ttaagggtctcgcatggatt, hlh-33_41, 41, 976, 45 gaaaggtcttgttgagctaa, hlh-33_42, 42, 1013, 40


Input sequence with probe locations:


atgtccgactccccgcagagctgcaaaaagccgcgaactcggaaagaaactattcaaaagcgagaaacac

        aggggcgtctcgacgttttt   cgcttgagcctttctttgat  gttttcgctctttgtg
        Probe # 1, 55% GC      Probe # 2, 45% GC     Probe # 3, 45% G

gaagtaagcatgaaaaacgacgaagggaagagatgaatgaagtgatttgtgaaatgtcgacacttttgcc cttc tcgtactttttgctgcttcc ctctacttacttcactaaac tttacagctgtgaaaacgg C Probe # 4, 45% GC Probe # 5, 35% GC Probe # 6, 45% GC

cgaagatattcgggctcataagctgcgaagagtggatcagaagcctcgtcagctggacaaatgctttatc g tctataagcccgagtattcg gcttctcacctagtcttcgg cagtcgacctgtttacgaaa g

  Probe # 7, 45% GC     Probe # 8, 55% GC     Probe # 9, 45% GC     P

attgggagtactgttgatattattcggaatagtgattataaaccaccgctgctctccgacccgctcgtcc taaccctcatgacaactat cactaatatttggtggcgac ggcgagcagg robe # 10, 40% GC Probe # 11, 45% GC Probe # 12

aggatattttcagcctgaccaactgttttatggtttttctgaacaattttattgtcgtggatattaaggg tcctataaaa cggactggttgacaaaatac taacagcacctataattccc , 50% GC Probe # 13, 45% GC Probe # 14, 40% GC

agaccatcaggcagtttttgatattgaaaaaaaacgtatgattggaaaagatatccgatgttttctggac

 tggtagtccgtcaaaaacta   cttttttttgcatactaacc   tctataggctacaaaagacc  
 Probe # 15, 40% GC     Probe # 16, 30% GC     Probe # 17, 40% GC    

tacgattcaacgtccaaactgtcatttctcacttccaaagaaatgctcaatgagctccaactcaaaagct atgctaagttgcaggtttga gtaaagagtgaaggtttctt cgagttactcgaggttgagt tcga Probe # 18, 40% GC Probe # 19, 35% GC Probe # 20, 50% GC Prob

tcatggcgaagtcaatgacgtgcagaataaaggaatcggcggagaaacccacggaaacagttttagtctg agtaccgcttcagtta gcacgtcttatttccttagc cctctttgggtgcctttgtc aatcagac e # 21, 45% GC Probe # 22, 45% GC Probe # 23, 55% GC Probe #

tgtgcctgatgagcttccagctctcccggttactgtacccaaggctccgcccattttagcttcgcccctt acacggactact aaggtcgagagggccaatga ggttccgaggcgggtaaaat aagcggggaa 24, 45% GC Probe # 25, 55% GC Probe # 26, 55% GC Probe # 27

cagaagacaccgcccccgccgtcgagtttggaggtgaaaagcccgattttggcggcacttttgaggcgaa gtcttctgtg cagctcaaacctccactttt ggctaaaaccgccgtgaaaa ccgctt , 55% GC Probe # 28, 45% GC Probe # 29, 50% GC Probe

aagaggataattgtgtgaaagtgagctccccaagctccttcctctcgccgggctcctccacctcgtctac ttctcctattaaca ctttcactcgaggggttcga tggagcagatg

  1. 30, 40% GC Probe # 31, 55% GC Probe # 32,

agtacccaatgtgaaacctacagtaacccgccgacctacagtacccacaaaacggaagagactacgatcg tcatgggtt actttggatgtcattgggcg tggatgtcatgggtgttttg ctctgatgctagc

50% GC    Probe # 33, 50% GC    Probe # 34, 45% GC      Probe # 35, 4

atgaatgttatagtggaaagttatccgttggatgatgagaagtcggatggaaattcacaaaaatcggcga tacttac tatcacctttcaataggcaa tactactcttcagcctacct aagtgtttttagccgct 5% GC Probe # 36, 35% GC Probe # 37, 45% GC Probe # 38, 35% G

aaattgggaaaaagaggttttttctaacaaaaaaaaacgttaaaacctacagtaatctactccaaaatcc ttt ccctttttctccaaaaaaga ttggatgtcattagatgagg ttagg C Probe # 39, 35% GC Probe # 40, 40% GC Probe

atgcgagacccttaaaactgaaaatttcaaatttagctcaacaagacctttcaaatga tacgctctgggaatt aatcgagttgttctggaaag

# 41, 45% GC                   Probe # 42, 40% GC
Personal tools