Wilfred J. Poppinga/Notebook/Wilfreds Project/2009/07/28/CueO-RBS REV

From OpenWetWare

Jump to: navigation, search

Sequence CueO-RBS Reverse oligo

5'- CTAGTAAAATCAAACGTTGAGCATAGTCCTTCCCCTTACGGGAAGGTCAACTCTAGAAGCGGCCGCG - 3'

Personal tools