NanoBio: Commonly Used Primers: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
New page: == Commonly Used Primers == * Sequencing primers for Biobrick & Biofusion vectors: ** pSB1A3, pSB1AC3, pSB1AK3, pSB1AT3 forward primer: 5' AAATAGGCGTATCACGAGGC 3' ** pSB1A3, pSB1AC3, pSB1...
 
Line 16: Line 16:


* Sequencing primers for other vectors
* Sequencing primers for other vectors
pET vectors 5' atgcgtccggcgtaga
**pET vectors 5' atgcgtccggcgtaga
T7 promoter 5' taatacgactcactataggg
**T7 promoter 5' taatacgactcactataggg
T7 terminator 5' gctagttattgctcagcgg
**T7 terminator 5' gctagttattgctcagcgg


*'''[[User:CarolineAjo-Franklin|CAjoF]] 20:27, 29 January 2008 (CST)''':
*'''[[User:CarolineAjo-Franklin|CAjoF]] 20:27, 29 January 2008 (CST)''':

Revision as of 02:29, 30 January 2008

Commonly Used Primers

  • Sequencing primers for Biobrick & Biofusion vectors:
    • pSB1A3, pSB1AC3, pSB1AK3, pSB1AT3 forward primer: 5' AAATAGGCGTATCACGAGGC 3'
    • pSB1A3, pSB1AC3, pSB1AK3, pSB1AT3 reverse primer: 5' GAGTCAGTGAGCGAGGAAGC 3'
    • V0100/V0120 forward sequencing primer: 5' GGGTTTTCCCAGTCACGACG 3'
    • V0100/V0120 reverse sequencing primer: 5' TGTGGAATTGTGAGCGGATAACA 3'
    • V0002 forward sequencing primer: 5' tttctggaattcgcggcc 3'
    • V0002 reverse sequencing primer: 5' gccggactgcagcggcc 3'
  • Primers that sequence regions between the Biobrick ends
    • upstream of a Kozak region (K0001): 5' TCTAGTCTCCATGGTGGCGG 3'
    • downstream of a Kozak region (K0001): 5' CCGCCACCATGGAGACTAGA 3'
    • upstream of the ADH1 terminator (L0100): 5' CCTGAGAAAGCAACCTGACCTACAG 3'
    • downstream of midpoint btwn yeast-codon optimized YFP/mCherryx2 (Z0035 or Z0037): 5' GGTACCGCAACTAGAGCAACTAGC 3'
    • upstream of midpoint btwn yeast-codon optimized YFP/mCherryx2(Z0035 or Z0037): 5' GCTAGTTGCTCTAGTTGCGGTACC 3'
  • Sequencing primers for other vectors
    • pET vectors 5' atgcgtccggcgtaga
    • T7 promoter 5' taatacgactcactataggg
    • T7 terminator 5' gctagttattgctcagcgg
  • CAjoF 20:27, 29 January 2008 (CST):