NanoBio: Commonly Used Primers

From OpenWetWare
Jump to navigationJump to search

Commonly Used Primers

  • Sequencing primers for Biobrick & Biofusion vectors:
    • pSB1A3, pSB1AC3, pSB1AK3, pSB1AT3 forward primer(AF009): 5' AAATAGGCGTATCACGAGGC 3'
    • pSB1A3, pSB1AC3, pSB1AK3, pSB1AT3 reverse primer (AF010): 5' GAGTCAGTGAGCGAGGAAGC 3'
    • V0100/V0120 forward sequencing primer (AF039): 5' GGGTTTTCCCAGTCACGACG 3'
    • V0100/V0120 reverse sequencing primer (AF040): 5' TGTGGAATTGTGAGCGGATAACA 3'
    • V0002 forward sequencing primer: 5' tttctggaattcgcggcc 3'
    • V0002 reverse sequencing primer: 5' gccggactgcagcggcc 3'
  • Primers that sequence regions between the Biobrick ends
    • upstream of a Kozak region (K0001): 5' TCTAGTCTCCATGGTGGCGG 3'
    • downstream of a Kozak region (K0001): 5' CCGCCACCATGGAGACTAGA 3'
    • upstream of the ADH1 terminator (L0100): 5' CCTGAGAAAGCAACCTGACCTACAG 3'
    • downstream of midpoint btwn yeast-codon optimized YFP/mCherryx2 (Z0035 or Z0037): 5' GGTACCGCAACTAGAGCAACTAGC 3'
    • upstream of midpoint btwn yeast-codon optimized YFP/mCherryx2(Z0035 or Z0037): 5' GCTAGTTGCTCTAGTTGCGGTACC 3'
  • Sequencing primers for other vectors
    • pET vectors 5' atgcgtccggcgtaga
    • T7 promoter 5' taatacgactcactataggg
    • T7 terminator 5' gctagttattgctcagcgg
  • CAjoF 18:44, 17 June 2008 (UTC)