User:Bill Flanagan: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
mNo edit summary
Line 23: Line 23:
[http://docs.google.com/Doc?docid=0ASDsQEE7oV5uZHpjamdtMl8xMWhrdzh3a2N4&hl=en]
[http://docs.google.com/Doc?docid=0ASDsQEE7oV5uZHpjamdtMl8xMWhrdzh3a2N4&hl=en]


{{ShowGoogleExcel|id=0ASDsQEE7oV5uZHpjamdtMl8xMWhrdzh3a2N4|width=500|height=300}}
<GoogleDocs />
 
{{#widget:Google Spreadsheet
|key=0ASDsQEE7oV5uZHpjamdtMl8xMWhrdzh3a2N4
|width=500
|height=300
}}
 


===Wiki1001===
===Wiki1001===

Revision as of 21:34, 13 August 2009

My name is Bill Flanagan.


I'm the Senior Technology Developer for OpenWetWare.

I work for MIT in the Department of Biological Engineering.

My background is in building online systems to facilitate collaboration.


Contact

  • For OWW logged-in members: Click Here
  • Email: bill at openwetware dot org

Google Docs

[1]

<GoogleDocs />

Wiki1001

Site URL: http://www.wiki1001.com
OWW Page: http://www.wiki1001.com/wiki/25

Wiki1001.com tracks Internet Wikis. OpenWetWare.org was added recently to it. Take a look at the site. Feel free to say something about OWW (great, good, or otherwise!)

BioBricks

BBa J22001

PMID 123456


>BBa_J22001 Part-only sequence (2630 bp) <dnaseq> aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggaaagtactagatgattaaccgtatccgc gtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagct ttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgcgcattaacctgagtcgttcagcggtacg gatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaa ttcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgatt acctagattatggcaatactggagcttatttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtga aaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctg gtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctga ccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatgcaacgctctttgactgacaccgtcactcatgtccgcgaaggttcaga tgccatctatgccggtacccgtgaaattgcggcgggcaacaccgatctttcctcccgtactgaacagcaggcatccgcgctggaagaaactgccgccagc atggagcagctcaccgcgacagtgaagcaaaacgccgataacgcccgccaggcctcgcaactggcgcaaagtgcctccgacaccgcccagcacggcggca aagtggtggatggcgtagtgaaaacgatgcatgagatcgccgatagttcgaagaaaattgccgacattatcagcgttatcgacggtattgccttccagac taatatcctcgcgctgaatgccgcggttgaagccgcgcgtgcgggtgaacagggccgtggttttgccgtggtggcgggtgaagtgcgtaatcttgccagt cgcagcgcccaggcggcaaaagagatcaaagccctcattgaagactccgtctcacgcgttgataccggttcggtgctggtcgaaagcgccggggaaacaa tgaacaatatcgtcaatgctgtcactcgcgtgactgacattatgggcgagattgcatcggcatcggatgaacagagccgtggcatcgatcaagtcgcatt ggcggtttcggaaatggatcgcgtcacgcaacagaacgcatcgctggtgcaggaatcagctgccgccgccgctgcgctggaagaacaggcgagtcgttta acgcaagcagtttccgcgttccgtctggcagccagcccactcaccaataaaccgcaaacaccatcccgtcctgccagtgagcaaccaccggctcagccac gactgcgaattgctgaacaagatccaaactgggaaacattttgatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcacc ggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctga ccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccga ccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgc gccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt acaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgt gcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaa gaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactaga gccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct caccttcgggtgggcctttctgcgtttata </dnaseq>

Barcodes

References

Examples

Absolute pagename: Generate a simple barcode

<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=http://openwetware.org/wiki/User:Bill Flanagan&choe=UTF-8' /> </html>

<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=User:Bill Flanagan&choe=UTF-8' /> </html>

Use OWW FULLPAGENAME to generate the pagename:

Size: 100x100

<html> <img src='http://chart.apis.google.com/chart?chs=100x100&cht=qr&chl=http://openwetware.org/wiki/</html>User:Bill Flanagan<html>&choe=UTF-8' /> </html>

Neural Networks

References

Prediction of the response under impact of steel armours using a multilayer perceptron

Impact Time and Point Predicted Using a Neural Extended Kalman Filter

Ballistic Performance Evaluation of Multi-layered Armors using Neural Network Algorithm

Prediction of the behaviour of CFRPs against high-velocity impact of solids employing an artificial neural network methodology

Underground blast induced ground shock and its modelling using artificial neural network

Rankine–Hugoniot equation

Wikipedia: Neural Network

User:Bill Flanagan/docs/Multi-touch screens and neural networks

Error Backpropagation Neural Calibration and Kalman Filter Position Estimation for Touch Panels

Terms

[neural extended]

[Kalman filter]

[multilayered perceptron]

[artificial neural network]

[Rankine-Hugoniot]

AI

Why AI Failed

BioJava

Link: BioJava

BioJava is dedicated to providing a Java framework for processing biological data. It include objects for manipulating biological sequences, file parsers, DAS client and server support, access to BioSQL and Ensembl databases, tools for making sequence analysis GUIs and powerful analysis and statistical routines including a dynamic programming toolkit.

BioJava is used in several real-world bioinformatics applications and has been used for bioinformatics analysis in a number of published studies.

Bitnami

Link: Bitnami

MediaWiki Extension Matrix

Link: Mediawiki Extension Matrix

PHP Tube: PHP Upload class for YouTube

Link: [2]

MediaWiki: Magic Words

Link: Magic Words

DNASis SmartNote

MiraiBio has introduced a free lab notebook on their site free for all users.

You can check it out here.

It's well worth a look.

SmartNote is a bona-fide Web 2.0 application. It relies heavily on Javascript using the Dojo.js Javascript library for much of its interaction. It has many "snap-in" tools for doing analysis of DNA sequences. One of the nice features it has is a genome annotation tool. I'm particularly interested in people's reactions to this particular feature. This is their contact information:

MiraiBio (a Hitachi subsidiary) 601 Gateway Blvd. Suite 100 South San Francisco, CA 94080 800-624-6176 www.miraibio.com

Intro Books on Bioinformatics and PCR

(todo: reformat via biblio/cite with isbn numbers, etc)

From: Aaron Hicks

From: Felix:


From: Michael Vieths

Other:

Quasi-Public-Accessible Biology Lab Facilities

(New content: to be moved to appropriate pages when I have time)

Wake Forest: Babcock Demon Incubator

North Carolina

Website: wfubdi.org/bioscience.php

The incubator can provide fully equipped shared wet lab space for early stage bioscience companies. The wet lab space is located in the Piedmont Triad Research Park. The facilities include chemistry and tissue hoods, gas, air, materials disposal, internet access, etc. A partial list of equipment in the lab can be found on the facilities page. In addition to the use of the wet lab, incubator clients can use break room facilities and schedule conference rooms as required.

Equipment:

  • LCMS, single quad / UPLC system with PDA detector, auto-sampler and column heater
  • UPLC system with PDA detector, auto-sampler, column heater and peptide platform
  • Alliance HPLC system with UV/Vis detector, degas system and column heater
  • GC - 2010, auto injection system
  • Nitrogen Generator – 30 L /min
  • UPS system – 5.2 KV
  • Empower software
  • Classic LAC/E32 Server
  • Oilless vacuum Pump

North Carolina Community College BioNetwork Pharmaceutical Center (NCCBNC)

http://www.ncbionetwork.org/index.cfm?dir=Pharmaceutical/center.cfm&sec=4

The BioNetwork Pharmaceutical Center operates as a collaborative venture between Forsyth Technical Community College and Guilford Technical Community College to serve all community colleges in the state. The administrative offices of the Pharmaceutical Center are located in the Piedmont Triad Research Park.

The Pharmaceutical Center is a statewide liaison between pharmaceutical manufacturing needs and worker training. The Center provides leadership in general pharmaceutical manufacturing to improve the quality of learning, training and services at all NC community colleges and to recruit students for their programs.

The Center also works with economic development leaders in the state to help recruit new companies to North Carolina.

The Center coordinates funded innovation and equipment facility projects as individual colleges expand and enhance the capacity of NC community colleges to educate and train individuals in the biotechnology industry

Just like the NCCCS, the Pharmaceutical Center has partners in industry, commerce, economic development organizations, secondary education, public and private colleges and universities.

Lab Equipment Categories

  • Lab Equipment
  • Analytical Instruments
  • Autoclaves & Sterilizers
  • Centrifuges & Parts
    • Centrifuges
    • Rotors & Parts
    • Other
  • Cleaning Equipment
  • Evaporators
  • Fermenters
  • Furnishings & Facilities
  • Heating & Cooling
    • Burners & Hotplates
    • Cryogenics
    • Environmental Chambers
    • Freezers & Fridges
    • Heating Mantles
    • Hoods
    • Laboratory Furnaces
    • Laboratory Ovens
    • Temperature Monitoring
    • Water Baths & Chillers
    • Other
  • Incubators
  • Lab Lasers & Photonics
  • Lab Scales & Balances
    • Digital Scales & Balances
    • Mechanical & Beam Balances
    • Weights & Calibration Sets
    • Other
  • Microscopes
  • Microscope Parts & Accessories
  • Microtomes
  • Mixers
  • Motion Control
  • Power Supply
  • Pumps
  • Recorders & Plotters
  • Shakers
  • Stirrers
  • Others

Recent Biobricks

<xfeeds>http://partsregistry.org/wiki/index.php?title=Special:Recentchanges&feed=rss</xfeeds>

Representative PCR Models

Perkin Elmer GeneAmp 2400 PCR System Thermal Cycler Perkin Elmer GeneAmp 7500 Realtime Perkin Elmer GeneAmp 9600 Perkin Elmer GeneAmp 9700 Perkin-Elmer GeneAmp 1000 Perkin Elmer Prism 7700 Perkin Elmer Cetus 480 DNA Thermal Cycler Mini Horizontal Electrophoresis PCR Agarose Gel System NewGeneAmp 9600 Thermal Cycler Stratagene Thermocycler model SCS-2 Techne TouchGene Gradient 96 Well Thermal Cycler Techne Genius FGEN02TP Thermal Cycler Hybaid TR3 Omnigene Thermal Cycler Sigma-Aldrich Alumaseal 96 film adhesive plates Biometra Trio-Thermoblock TB-1 Thermocycler Ericomp TwinBlock EZ Thermal Cycler THERMOLYNE BARNSTEAD TEMP-TRONICTHERMAL CYCLER ERICOMP EZ SINGLEBLOCK Thermal Cycler ERICOMP EZ POWERBLOCK II Thermal Cycler Hybaid Omnislide System PCR Thermal Cycler Eppendorf Mastercycler 96 Watt GradientThermal Cycler COY Model 50 TempCycler 35-Well Temperature Cycler

Message

Reference section for Dr. Elana Vanderlay still under construction.

Watch this space for exciting developments.


SlideShare

Error in widget SlideShare: Unable to load template 'wiki:SlideShare'