User contributions
From OpenWetWare
(Latest | Earliest) View (newer 50) (older 50) (20 | 50 | 100 | 250 | 500)
- 21:49, 3 July 2008 (hist) (diff) Image:SDM gel1a.tif (uploaded a new version of "Image:SDM gel1a.tif") (top)
- 17:44, 3 July 2008 (hist) (diff) Sandbox/excel1 (top)
- 16:49, 3 July 2008 (hist) (diff) Image:SDM RNA2a.tif (uploaded a new version of "Image:SDM RNA2a.tif") (top)
- 16:45, 3 July 2008 (hist) (diff) Image:SDMHorn2a.tif (uploaded a new version of "Image:SDMHorn2a.tif") (top)
- 14:40, 3 July 2008 (hist) (diff) Sandbox/excel1
- 14:38, 3 July 2008 (hist) (diff) Sandbox/excel1
- 14:29, 3 July 2008 (hist) (diff) Sandbox/excel1
- 14:28, 3 July 2008 (hist) (diff) Sandbox/excel1 (New page: {| class="wikitable" |- ! ! F |- | 3 | |- | 4 | |- | 6 | |- | 7 | |- | 9 | |- | 10 | |- | 12 | |- | 13 | |- | 15 | |- | 16 | |- | 17 | |- | 19 | |- | 20 | |- | 22 | J23030 |- | 23 | |- | 2...)
- 09:50, 3 July 2008 (hist) (diff) Sandbox/excel (top)
- 09:47, 3 July 2008 (hist) (diff) Sandbox/excel (New page: {| class="wikitable" |- ! A ! B ! C ! D ! E ! F |- | J23006 | KB001 | Forward EcoRI to construct Ptet part-making biobrick plasmid | ttctggaattcgcggccgcaactagagccaggcatc | ok | |- | | KB...)
- 22:23, 2 July 2008 (hist) (diff) MediaWiki:Tif-long-desc (New page: (TIFF file, nominally $1 × $2 pixels, file size: $3)) (top)
- 22:18, 2 July 2008 (hist) (diff) Image:Tumorcells.tif (uploaded a new version of "Image:Tumorcells.tif") (top)
- 00:24, 1 July 2008 (hist) (diff) MediaWiki:Monobook.js (top)
- 00:05, 1 July 2008 (hist) (diff) MediaWiki:Monobook.js
- 23:58, 30 June 2008 (hist) (diff) MediaWiki:Monobook.js
- 16:58, 28 June 2008 (hist) (diff) OpenWetWare:CurrentUsers (top)
- 16:55, 28 June 2008 (hist) (diff) OpenWetWare:CurrentUsers
- 16:54, 28 June 2008 (hist) (diff) OpenWetWare:CurrentUsers
- 16:47, 28 June 2008 (hist) (diff) Template:NewUsers (top)
- 16:46, 28 June 2008 (hist) (diff) OpenWetWare:CurrentUsers
- 16:45, 28 June 2008 (hist) (diff) OpenWetWare:CurrentUsers (New page: {| |'''Openwetware users as of {{LOCALTIME}}''' |- |{{#currentusers:}} |- |})
- 16:42, 28 June 2008 (hist) (diff) Sandbox:CurrentUsers (top)
- 16:38, 28 June 2008 (hist) (diff) Sandbox:CurrentUsers
- 16:37, 28 June 2008 (hist) (diff) Sandbox:CurrentUsers
- 16:36, 28 June 2008 (hist) (diff) Sandbox:CurrentUsers
- 16:36, 28 June 2008 (hist) (diff) Sandbox:CurrentUsers
- 01:15, 28 June 2008 (hist) (diff) OpenWetWare:Software/Image Editor/Gel annotation (top)
- 01:13, 28 June 2008 (hist) (diff) OpenWetWare:Software/Sandbox/Image Editor/Gel annotation (top)
- 01:12, 28 June 2008 (hist) (diff) OpenWetWare:Software/Sandbox/Image Editor/Gel annotation (New page: == SVG description == <svg xmlns:svg="http://www.w3.org/2000/svg" xmlns="http://www.w3.org/2000/svg" xmlns:xlink="http://www.w3.org/1999/xlink" version="1.0" width="744.09448" height="105...)
- 19:17, 27 June 2008 (hist) (diff) OpenWetWare:Steering committee/Town Hall Meeting (top)
- 19:16, 27 June 2008 (hist) (diff) OpenWetWare:Steering committee
- 19:05, 27 June 2008 (hist) (diff) OpenWetWare:Steering committee/Town Hall Meeting/Entry Base (New page: ==Welcome to the OWW Community Town Hall Meeting for July, 2008== Use these URL's to get to the chat room if you can't get there from here: *room url: [http://www.meebo.com/room/owwcommun...) (top)
- 19:03, 27 June 2008 (hist) (diff) OpenWetWare:Steering committee/Town Hall Meeting
- 18:57, 27 June 2008 (hist) (diff) OpenWetWare:Steering committee/Town Hall Meeting/2008/07/10 (New page: ==Welcome to the OWW Community Town Hall Meeting for July, 2008== Use these URL's to get to the chat room if you can't get there from here: *room url: [http://www.meebo.com/room/owwcommun...)
- 12:13, 26 June 2008 (hist) (diff) Sandbox:sortable (top)
- 12:13, 26 June 2008 (hist) (diff) Sandbox:sortable
- 12:10, 26 June 2008 (hist) (diff) Sandbox:sortable
- 12:09, 26 June 2008 (hist) (diff) Sandbox:sortable
- 12:08, 26 June 2008 (hist) (diff) Sandbox:sortable
- 12:07, 26 June 2008 (hist) (diff) Sandbox:sortable
- 12:04, 26 June 2008 (hist) (diff) Sandbox:sortable (New page: <html> <link type="text/css" rel="stylesheet" href="/css/examples.css" /> <link type="text/css" rel="stylesheet" href="/os3grid.css" /> <script src="/js/os3grid.js" type="text/javascript">...)
- 02:15, 26 June 2008 (hist) (diff) User:Bill Flanagan (top)
- 22:06, 24 June 2008 (hist) (diff) Sandbox:Stats (top)
- 22:04, 24 June 2008 (hist) (diff) Sandbox:Stats
- 22:02, 24 June 2008 (hist) (diff) Sandbox:Stats
- 21:44, 24 June 2008 (hist) (diff) Sandbox:Stats
- 21:41, 24 June 2008 (hist) (diff) Sandbox:Stats
- 21:38, 24 June 2008 (hist) (diff) Sandbox:Stats (New page: <h3>Users daily (60 days)</h3>{| style="width:50%" |- | {| style="width:50%" border="1" |+ test ! 2!!2!!1 |- !20080412 |2 |- !20080413 |3 |- !20080414 |5 |- !20080415 |5 |- !20080416 |1...)
- 21:47, 23 June 2008 (hist) (diff) Sandbox/stats (New page: {{#currentusers:}}) (top)
- 20:23, 23 June 2008 (hist) (diff) User:John Q. Smith/Notebook/Remote control stem cells/2008/06/25 (Autocreate 2008/06/25 Entry for User:John_Q._Smith/Notebook/Remote_control_stem_cells) (top)
(Latest | Earliest) View (newer 50) (older 50) (20 | 50 | 100 | 250 | 500)
