Knight:Orders: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Austin J. Che (talk | contribs)
No edit summary
 
(349 intermediate revisions by 12 users not shown)
Line 6: Line 6:


==Needs to be Ordered==
==Needs to be Ordered==
* 96-deepwell plates (for DeLong MP robot)
*Lithium Energizer Batteries (50)
* Teknova plates
*Labels TZe-231 1/2in tape (8)
* petri plate labels (for QC)
 
==Placed Orders==
* Labels TZ-241 White - 18 cassettes
* Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK) 8 Packs
* Packing tape
* 500ml Vacuum Filters (VWR 28199-307) - 1 Box
* Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
* Falcon 14ml Snap Cap Tubes (352059)
* Rechargeable NiMH Battery - 53498-063 VWR (for Pipet-aid) (2)
 
 
 
==Received Orders==
<small>(Please make sure to update this or tell Meagan if you receive an order -- and make sure to save the packing slip)</small>
{{hide|1=
* 384 well Nunc Plate w/ Lid (VWR 82030-992) - 12 boxes of 100 each
* 30ml epMotion Reservoirs (Cat No. 960051009) - 2 boxes
* Cresol Red (114480-5GM) - 2 bottles (10g total)
* PCR SuperMix High Fiedlity (6 boxes)
* NALGENE cryoware cryogenic vials Cat #5000-0020 - 1 Case (sent incorrect type)
* NUNC Universal Lids (VWR 73520-150, Nunc 250002) - 2 Boxes
* Adhesive Foil (60941-076) - 30 boxes of 50 each
* 50ml Conical Tubes (Corning 430290 or VWR 20171-028) - 1 Case
* Red Skirted PCR Plates (Cat No. 951020486) - 2 boxes
* TE (17890) - 2L
*250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
*VWR reservoirs - 89094-658 2 boxes
*Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
*Invitrogen CC
**48-well e-gels (1 box)
**PCR supermix (1 box)
*10ul Tips - ART Reach (4 PACKS (not cases) - 40 tip boxes) (VWR 53509-500)
* PCR supermix - 4 boxes
* E-gel 48 (G800801) - 5 boxes
* E-gel 12-well (G501808) - 3 boxes
* PCR supermix (6) 4/29
* PCR supermix (6) 4/28
* 6 - P-Touch Labels TZ241 (Black Print on White labels)
* VWR Foil Seals - 60941-076 - 10 boxes (ordered 15)
* 1.2ml MC Tips RT-L1200F - 2 boxes
* Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
* Ethanol 200 and 190 proof
* Plasmid Prep Kit 10pc kit 2300210
* Cardboard Boxes (MD664) (25per pack) - 5 packs for Teams, 8 packs for Labs
* Bubble Wrap (Staples 468264) - 4 boxes for Labs
* Packing Tape (Staples 473975) - 2 packs* TE - 17890 - 2 L
* Invitrogen PCR SuperMix High Fidelity (10790-020) - 9 boxes
* Primer for Linearized BB - gccgctgcagtccggcaaaaaaacg "SB-prep-3P"
* Primer for Linearized BB - atgaattccagaaatcatccttagcg "SB-prep-2Ea"
* Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
* Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each)  VWR 82030-992 (did 8 before)
*Primer PBB-ior-R - tttgcaagcagcagattacg
*Primer PBB-ior-F - tgaccaaaatcccttaacgtg
*Primer PBB-eoro-R - gctgaagccagttaccttcg
*Primer PBB-eoro-F - cgtcagaccccgtagaaaag
*Primer PBB-TETR-R - ctcatgagcgcttgtttcg
*Primer PBB-TETR-F - cgactcctgcattaggaagc
*Primer PBB-KANR-R - cgctcgtcatcaaaatcactc
*Primer PBB-KANR-F - tgttgatgcgctggcagt
*Primer PBB-CMR-R - gggcgaagaagttgtccata
*Primer PBB-CMR-F - cgatttccggcagtttctac
*Primer PBB-AMPR-R - caacgttgttgccattgct
*Primer PBB-AMPR-F - tctgacaacgatcggaggac
*Primer PBB-AMPR-Long-F - gcggccaacttacttctgac
*Primer PBB-CMR-Long-F - tacaccgttttccatgagca
*Primer PBB-KANR-Long-F - gggaaaacagcattccaggt
*Primer PBB-TETR-Long-R - cctatatcgccgacatcacc
* Nunc 384 deep well plates - 269390 - 2 boxes  VWR 73521-278
* Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each)  VWR 82030-992
* Clear Plate Lids - 300 lids (VWR 73520-150, Nunc 250002)
* 3M Micropore Tape (2 boxes)
* Double Sided Foam Tape (10 rolls)
* White Swan small women's Lab Coat (VWR# 80092-446)
* Hand Soap (3 bottles)
* 1ml epMotion Tip Racks - 960050088 - 2 boxes  (ordered 3)
* 48w E-gels - G8008-01 - 4 boxes
* VF2/VR primers for Genewiz
* Multi-channel Pipette: Pipet-Lite LTS 8-channel, 20 µl to 200 µl L8-200
* Multi-channel Pipette: Pipet-Lite LTS 8-channel, 5 µl to 50 µl L8-50
* SR-L250S Pipette Tips - 8 boxes (contains 5 tip racks each)
* 10ul Tip Racks (SR-L10F) - 8 boxes (contains 5 tip racks each)  
* 1.2ml MC Tip Racks - RT-L1200F - 2 boxes
* BSA - B9001S - 1 pack (4tubesx1.5ml)
* NEB Buffer 2 - B7002S - 1 pack
* 20ul Tips VWR - 2 boxes (14217-726)
* 200ul Tips VWR - 2 boxes (14217-728)
* 100 ml epMotion Reservoirs - 960051017 - 1 box
* 1ml epMotion Tip Racks - 960050088 - 8 boxes
* Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
* 96 well Round Bottom Plates - 3958 - 2 boxes
* 96 deep well Plates - 3960 - 4 boxes
* Petri Dishes (2 boxes) 25384-250
* Bleach
* Inoculating Loops 12000-806
* clear, skirted PCR Plate - 47744-124 - 4 boxes
* Foil Covers - 60941-076 - 40 boxes
* VWR reservoirs - 89094-658 2 boxes
* TE (2 bottles) Thermo Scientific # 17890
* Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
* Corning 96-deepwell plates (3960) - 6 cs
* VWR Autoclave bags 14220-042
* Cresol Red Sigma-Aldrich 114480-5GM
* 48 Well E-gels (Invitrogen G800801)
* 10ul Tips - ART Reach (4 cases - 40 tip boxes) (VWR 53509-500)
* clear, skirted PCR plate (1 box of 25) (47744-124)
* LB Agar (9 bottles) (VWR 90003-112)
* Petri Dishes (3000, 6 boxes of 500) (25384-250)  -- only ordered 2 boxes
* 20ul pipette tips (4 cases - 40 tip boxes) 14217-726
* Reservoirs (2 boxes) (new #: 89094-658)
* VWR Foil Seals (8 boxes of 50 seals) (VWR 60941-076)
* Glass Beads (2 bottles) (VWR 26396-521)
* Avery Easy Peel Address Labels (4 packs) (8160)
* 10ul Tip Racks MC (SR-L10F) (4 cases - 20 tip boxes)
* 250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
* 1.2ml Tip Racks MC (RT-L1200F) (3 cases - 15 tip boxes)
* 96 well Round Bottom Plates (2 boxes) (3958)
* 96 well Deep Well Plates (2 boxes) (3960)
* 1300 Cm Plates
* 600 Amp Plates
* Microflex Gloves (S, M, & L?)  EV-2050-L
* VWR Foil Seals  (VWR 60941-076)
* Perfect Prep Kit
*Agar Broth/Plates
** LB Agar (3 bottles)  (VWR 90003-112)
** Petri Dishes (1200 count at least) (25384-250)
** SOB Media (1 bottle) (VWR 90003-336)
** LB Broth (2 bottles)  (VWR 90003-118)
** Chloramphenicol (C0378-5G)
** Ampicillin  (A9518-25G)
** Kanamycin (K1637-5G)
** Tetracyclin (87128-25G)
** 96 well Deep Well Plates (3960)
*Restriction Digests
** EcoRI
** PstI
** NEB Buffer 2
** Hard Shell PCR Plates (twin.tec) (VWR 47744-124)
** 48w E-gels
*Pipette Tips
** 10ul Tip Racks MC (SR-L10F)
** 250ul Tip Racks MC (SR-L250S/F)
** 1.2ml Tip Racks MC (RT-L1200F)
* Brother TZ-241 Tape 3/4inch 18mm (White)
* Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK)
* Bubble Wrap
* Perfectprep Plasmid 96 VAC 10/pk Kit
* epTIPS 40-1000uL (Cat No. 960-05008-8)
* epMotion Resevoir - 100mL (Cat No. 960051017)
* epMotion Resevoir - 30mL
* VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
* Corning MiniPrep Assay Plates 2ml - 3960
* VWR 200uL Barrier Tips (Cat No. 14217-728)
* 10ul/20ul Tip Racks (SR-L10F)
* 2.0mL Microtubes - (MCT-200-C-S)
* Bleach
* Corning 96w Clear Flatbottom Plates - 3651
* 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
* PCR Supermix
* 12-well E-gels
* Falcon 14ml Snap Cap Tubes (352059)
* VWR Reagent Reservoirs (new #: 89094-658)
* Glass beads (VWR 26396-521)
* Aluminium Foil
* 2-log Ladder from New England Biolabs #N3200L
* EcoRI
* NheI
* Sigma  Aldrich 123072-5G, Luminol, 5 gram (never received)
* LB Agar
* Nunc Ampule Boxes [Cartridges] #534479
* Nalgene Cryoware, cryogenic vials
* E-Gel 0.8% agarose, 18 per box, Cat no, G5018-08, Invitrogen
* 2x 4 liter 10x TAE buffer
* 2x QS710 gel casting tray with casting system, VWR IB51030
* 5x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
* 5x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
* QS710 horizontal gel unit, VWR IB51000
* 50 ml pipets
* pack 500, Axygen 0.5 ml tubes, orange, SCT-050-SS-O VWR 10011-516
* pack 500, Axygen 0.5 ml tubes, red, SCT-050-SS-R VWR 10011-520
* pack 500, Axygen 0.5 ml tubes, green, SCT-050-SS-G VWR 10011-512
* pack 500, Axygen 0.5 ml tubes, yellow, SCT-050-SS-Y VWR 10011-526
* Ethanol (200 and 190 proof)
* Promega Wizard SV96 PCR cleanup startup kit, Promega A6790, VWR PAA6790
* Qiagen Miniprep kit-- down to last bag of columns and I will probably use them between this week and next week. . .
* PCR SuperMix
* NUNC Universal lids, sterile (VWR 73520-150, Nunc 250002)
* twin.tec PCR plate 96, skirted (Eppendorf# 951020486, VWR# 47744-124)
* Nunc Clear Lids (Universal) VWR 62409-118
* VWR Reagent Reservoirs (new #: 89094-658)
* 3m Micropore Tape
* Falcon 14ml Snap Cap Tubes (352059)
* case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
* Adhesive Foil for Microplates (VWR Cat No. 60941-076)
* Fireboy Butane Canisters (CV360) VWR 17919-890
* 2x case 500, Axygen self-standing conical screw cap tubes, sterile, assorted colors, Axygen SCT-050-SS-A-S, VWR 10011-502
* 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
* 3x cases 200 ul pipet tips, VWR 14217-728
* 3x cases 20 ul pipet tips, VWR 14217-726
* 3x cases 1000XL pipet tips, VWR 87006-060
* VF2 (for Vinoo)
* VR (for Vinoo)
* Suffix-F 5' A CTA GTA GCG GCC GCT GCA G 3' (for Vinoo)
* Prefix-R 5' T CTA GAA GCG GCC GCG AAT TC 3' (for Vinoo)
* 2 boxes 12 well 0.8% e-gels Invitrogen G5018-08
* Sterile reagent reservoirs 100ml case 100 VWR 82026-358
* 2x NEB DpnI R0176S
* Replacement parts for Eppendorf rotor A-4-62, should be available through VWR
** Eppendorf Replacement rubber mat, for 250 ml bucket adapters, set of 4 Eppendorf 022638483
** 2x Replacement adapter clamp, for 250 ml bucket adapters, set of 2  Eppendorf 022638467
* Difco LB Agar, Lennox
* 10ul Multichannel pipette tips
* Pack 16, TimeMed Indicator tape, 3/4" x 500", TimeMed TSI-534, VWR 14217-334
* Pack 16, Time Tape Red,3/4 in, 500" long, VWR 36427-040
* Pack 16, Time Tape Green,3/4 in, 500" long, VWR 36428-043
* Pack 16, Time Tape Yellow,3/4 in, 500" long, VWR 36426-048
* Pack 16, Time Tape Orange,3/4 in, 500" long, VWR 36427-506
* Pack 12, Griffin Low Form Beakers, 1000 ml, polypropylene, Nalgene 1201-1000, VWR 13915-147
* Beckman pH electrode, Epoxy, Semi-Micro, Gel-Filled, 6 x 150 mm, Beckman A51711, VWR BKA51711
* 3/4" TZ Labelling Tape (White)
** See http://www.concordsupplies.com/brother-tz-241-tape-cartridge-brother-tz241/45224.html
** Also note bundle of 36 available
* Case 72, Square polypropylene bottles, Narrow mouth, 30 ml, Nalgene 2016-0030, VWR 16120-732
* 2x Qiagen Genomic Tip 500/G, catalog 10262, Genomic DNA maxiprep kit
* 2x Qiagen Genomic DNA Buffer Set, catalog 19060
* 2x bottles bleach
* 1 case petri dishes
* Case 72, Boston Round polypropylene bottles, Narrow mouth, 8 ml, Nalgene 2006-9025, VWR 16066-981
* 2-hydroxy-propyl-beta-cyclodextrin Sigma H5784, 45% solution, 0.67 substitution, MW 1396
* Sigma C8754-5g co-carboxylase, 5 grams
* Sigma C3144-25mg Coenzyme A sodium salt, 25 mg
* Sigma F6625-100mg FAD, 100 mg
* Sigma N5755-100mg, NADH, 100 mg
* Sigma G8645-25g, Sodium glucuronate, 25 g
* Sigma A5960-25g, Ascorbic Acid, 25 g
* Sigma B4501-1g, biotin, 1 g
* Sigma P5710-25g, Calcium panothenate, 25 g
* Sigma P1504-100ml, Tween-40, 100 ml
* 48well E-Gel
* Nitrile gloves, medium
* Nitrile gloves, large
* PCR SuperMix cat: 10790-20, 2x5 each Invitrogen
* Sigma E6376 Erythromycin, 25 g
* 2x bottles Difco LB Agar, Lennox
* Petri Dishes w/ Ring (PD1905-500S) 2 boxes
* 20ul Pipette Tips
* 3x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
* 3x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
* 2x boxes E-Gels 12 well 0.8%
* 20ul pipette tips
* Axygen 2.0ml microtubes
* Qiagen Miniprep Kit
* Qiagen PCR Purification Kit
* 14 ml Falcon Polypropylene Round-Bottom tube, cat. # 352059
* Sybr Safe
* 2x bottles Difco SOB Medium #244310, 500g 
* Qiagen
** 9012595 Disposable Tips, 1100 ul (960)
** 9012596 Disposable Tips, 300 ul (960)
* From http://www.labarmor.com/ (use the two codes AUSTIN100 and A7780WT to get 5% off and free shipping)
** Chill Bucket Kit SKU #67218-100
** 8 Liters Bath Armor SKU #42370-008
* Three boxes of NEB 10-beta competent cells - # C3019I
* C-5097-100 ECOS 101 cells from http://www.bioexpress.com/index.html?wscdet_show=000000000150174000
* case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
* 3x SpeI NEB R0133S
* 3x XbaI NEB R0145S
* 2x pack 50 VWR electroporation cuvettes, 1 mm, VWR 89047-206
* 3x cases 200 ul pipet tips, VWR 14217-728
* 2x cases 12 Nalgene SFCA bottle top filters, 500 ml, VWR 291-4520
* Fireboy Butane Canisters (CV360) VWR 17919-890
* E-Gel 0.8% agarose (G5018-08), may want to order two-four boxes of these
* Invitrogen PCR SuperMix High Fidelity (10790-020), may want to order two since have been disappearing at high rate; ordering a 5000 rxn kit would be best
* invivogen LyoComp - E.coli GT116 lyo-116-11 http://www.invivogen.com/family.php?ID=189&ID_cat=7&ID_sscat=93#groupe204
* Sigma B6650-10MG 5-Bromo-4-chloro-3-indolyl β-D-glucuronide cyclohexylammonium salt
* Sigma S2647-100MG Spectinomycin dihydrochloride pentahydrate
* Macherey-Nagel
** 740730.1 : NucleoSpin Robot-8 Plasmid http://www.mn-net.com/tabid/10885/default.aspx
** 740668 : NucleoSpin 8 Extract II
** 740682 : Starter Set A
** 740683 : Starter Set B
** 740680 : MN Frame
* Medium latex gloves
*autoclave deodorizers (VWR 11214-703)
* Three boxes of NEB 10-beta competent cells - # C3019I
* 4x each of following
** L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
** L1004 - LB Agar Plates with Ampicillin-100. 100 mm Plates, sterile. 20 Pack.
** L1017 - LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack.
** L1232 - LB Agar Plates with Chloramphenicol-34, Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
* 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
* 200ul pipette tips
* 20ul pipette tips
* Qiagen spin miniprep kit 250
* Qiaex II gel purification kit
* 48-well egels
* 3x Drummond Portable Pipet-Aid rechargeable battery Drummond 4-000-035 VWR 53498-063
* 10uL pippette tips
* L5033 - LB Agar Plates with Tetracycline-15. 150 mm Plates, sterile. 20 Pack.
* L5025 - LB Agar Plates with Kanamycin-50. 150 mm Plates, sterile. 20 Pack.
* L5004 - LB Agar Plates with Ampicillin-100. 150 mm Plates, sterile. 20 Pack.
* L5017 - LB Agar Plates with Chloramphenicol-34. 150 mm Plates, sterile. 20 Pack.
*http://www.analytical-sales.com/
** Cat #: 24108 - 24 well square well plate - 1 case
* 6 sleeves LB-Tet plates from Teknova (VWR 100216-604)
* 1 box 14 mL culture tubes
* 48 well e-gels
* 48 well e-gels
* 250ul Multi-Channel Tips (Rainin SR-L250S)
* 5 boxes of NEB 10-beta competent cells - # C3019I
* Three boxes of NEB 10-beta competent cells - # C3019I
* NEB BstXI
* XbaI
* 20ul tips
* Tet plates from Teknova
* 2x boxes 12 well E-Gels
* Glass beads (VWR 26396-521)
* 2x NEB SpeI  R0133S
* 2x NEB EcoRI-HF  R3101S
* T4 DNA ligase (everyone seems to be out, order at least two aliquots?)
* 3x NEB 10-beta competent cells - # C3019I
* [http://www.neb.com/nebecomm/products/productE0546.asp BioBrick assembly kit]
* Teknova plates for distribution
* NUNC lids
*L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack - 4 of these
* reservoirs (VWR 82026-358)
* http://www.analytical-sales.com/
** minimum quantity of each of following
** Cat #: 47025 - 24 column, low profile plate
** Cat #: 96012 - 8 channel V-trough reservoir
** Cat #: 24108 - 24 well square well plate
* E-gels, .8% Agarose, 12 lane (down to last box, ~5 used already)
*10ul multi-channel pipet tips, there was only one left in the box today and I couldn't see any other boxes.
* Nutrient Broth (Difco 234000)
* Fireboy cartridges (VWR 17919-890)
* 6x pairs of scissors (apparently someone eats them)
* ATCC 49762 Providencia stuartii
* 3 cases 50 ml serological pipets BD 357550 (VWR 53106-441)
* 3 cases 10 ml serological pipets BD 357551 (VWR 53300-523)
* 2x case 5 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul
* 384-well plates (for Distribution)
* LB Agar Lennox (VWR 90003-112)
* 2x case 200 Autoclave bags, clear, VWR 14220-042
* petri dishes (25384-250)
* 10 ul tips (53509-500)
* Bleach
* lab notebooks (VWR TX126643MT)
*EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
*NEB 10-beta competent cells - # C3019I (order two boxes)
* 2-log Ladder from New England Biolabs #N3200L
* NEB M.EcoRI M0211S
* NEB SbfI-HF R3642S
* adhesive foil covers (for Distribution)
* [http://www.teknova.com/product-p/l1017.htm L1017 LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack] - 8 of these (for postdocs)
* PstI large
* XbaI large
* SpeI large (postdocs 3/11/09)
* Invitrogen PCR Supermix Hi-Fi (postdocs, 3/11/09)
*Qiagen QiaQuick PCR purification kit 250 - cat no. 28106
* 96-well egels
* 48-well egels
* 20ul tips
* 200ul tips
* adhesive foil covers (VWR 60941-076)
*Bio Rad Order #  IC0282947
** Biorad MLL-9601 - low profile unskirted natural pcr plates - ordered 1 pk
** Biorad MSP-9601 - microseal skirted natural  - ordered 2 pks
* Millipore Millex-GV Filter unit 0.22 um pore size filters catalog no. SLGVR25LS (Req #11115919)
* Microflex latex gloves small and large
* 2 boxes of 12 well E-gels (Req #11121281)
* Cartridges for Ptouch labeller. 18mm, 3/4", Black ink on white, TZ-241 TZ tape
* GE templiphi 500 25-6400-50
* Teknova plates: (ReqID #11115915)
** Amp L1004
** Amp-Cm L1243
** Amp-Kan L1210
** Amp-Tet L1216
** Kan L1025
** Cm L1017
* NEB Order# 219818-OL
** NEB - EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
** NEB lambda exonuclease M0262S
** NEB exonuclease III  M0206S
** NEB 10-beta competent cells - # C3019I (order two boxes)
* Egels 12 well 0.8%
* NEB 10-beta competent cells - # C3019I
* 14 ml Polypropylene Round-Bottom Tube
* mobio.com 12300-50 6 minute mini plasmid prep kit
* mobio.com 12300-50 6 minute mini plasmid prep kit
==Placed Orders==
* [http://www.neb.com/nebecomm/products/productF-531.asp Phusion™ High-Fidelity PCR Master Mix with HF Buffer] catalog # F-531S
* ReqID 11110523:
* ReqID 11110523:
**[http://www.teknova.com/product-p/l1017.htm L1017 LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack] - 6 of these
**[http://www.teknova.com/product-p/l1017.htm L1017 LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack] - 6 of these
Line 19: Line 399:
**[http://www.teknova.com/product-p/l1025.htm L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack] - 1 of these
**[http://www.teknova.com/product-p/l1025.htm L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack] - 1 of these
**[http://www.teknova.com/product-p/l5033.htm L5033 - LB Agar Plates with Tetracycline-15. 150 mm Plates, sterile. 20 Pack] - 1 of these
**[http://www.teknova.com/product-p/l5033.htm L5033 - LB Agar Plates with Tetracycline-15. 150 mm Plates, sterile. 20 Pack] - 1 of these
* 14 ml Polypropylene Round-Bottom Tube
* [http://www.neb.com/nebecomm/products/productF-531.asp Phusion™ High-Fidelity PCR Master Mix with HF Buffer] catalog # F-531S
* parafilm
* parafilm
<!-- * 2 cases petri dishes (25384-250) <font color=red>(Temporarily on backorder - until sep 30 <small>(acc. to Steve @ VWR on 9/09--[[User:Meaganl|Meaganl]] 14:14, 9 September 2008 (EDT))</small>)</font>
* 48 well e-gels
* 2x cases 12 Nalgene 290-4520 SFCA bottle top filter, 150ml, 45mm neck, 50 mm membrane, 0.2u filter (VWR 28199-300) <font color=red>(Temporarily on backorder)</font> -->
 
 
==Received Orders==
<small>(Please make sure to update this or tell Meagan if you receive an order -- and make sure to save the packing slip)</small>
{{hide|1=
* [http://www.neb.com/nebecomm/products/productB7002.asp NEBbuffer 2] (unless we have a stash somewhere, we used 2 of 4 tubes in big -20)
* [http://www.neb.com/nebecomm/products/productB7002.asp NEBbuffer 2] (unless we have a stash somewhere, we used 2 of 4 tubes in big -20)
* [http://www.neb.com/nebecomm/products/productM0202.asp NEB T4 DNA ligase]
* [http://www.neb.com/nebecomm/products/productM0202.asp NEB T4 DNA ligase]
Line 202: Line 576:
*Teknova AMP plates (VWR 100216-550)
*Teknova AMP plates (VWR 100216-550)
* [http://www.bhphotovideo.com/bnh/controller/home?O=WishList.jsp&A=details&Q=&sku=211969&is=REG Media cart for holodeck]
* [http://www.bhphotovideo.com/bnh/controller/home?O=WishList.jsp&A=details&Q=&sku=211969&is=REG Media cart for holodeck]
* Corning 96-deepwell plates (3960) - 6 cs
*ReqID: 10967075
*ReqID: 10967075
** Glycerol
** Glycerol

Latest revision as of 15:59, 11 August 2011

<html><style type='text/css'> .tabs {

 width: 750px;
 font-family: trebuchet ms;

}

.tabs strong{

 color: #602;

} </style></html>

CSAIL logo
Knight Lab




Orders will be placed every Thursday unless otherwise requested.

Needs to be Ordered

  • Lithium Energizer Batteries (50)
  • Labels TZe-231 1/2in tape (8)

Placed Orders

  • Labels TZ-241 White - 18 cassettes
  • Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK) 8 Packs
  • Packing tape
  • 500ml Vacuum Filters (VWR 28199-307) - 1 Box
  • Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
  • Falcon 14ml Snap Cap Tubes (352059)
  • Rechargeable NiMH Battery - 53498-063 VWR (for Pipet-aid) (2)


Received Orders

(Please make sure to update this or tell Meagan if you receive an order -- and make sure to save the packing slip)

  • 384 well Nunc Plate w/ Lid (VWR 82030-992) - 12 boxes of 100 each
  • 30ml epMotion Reservoirs (Cat No. 960051009) - 2 boxes
  • Cresol Red (114480-5GM) - 2 bottles (10g total)
  • PCR SuperMix High Fiedlity (6 boxes)
  • NALGENE cryoware cryogenic vials Cat #5000-0020 - 1 Case (sent incorrect type)
  • NUNC Universal Lids (VWR 73520-150, Nunc 250002) - 2 Boxes
  • Adhesive Foil (60941-076) - 30 boxes of 50 each
  • 50ml Conical Tubes (Corning 430290 or VWR 20171-028) - 1 Case
  • Red Skirted PCR Plates (Cat No. 951020486) - 2 boxes
  • TE (17890) - 2L
  • 250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
  • VWR reservoirs - 89094-658 2 boxes
  • Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
  • Invitrogen CC
    • 48-well e-gels (1 box)
    • PCR supermix (1 box)
  • 10ul Tips - ART Reach (4 PACKS (not cases) - 40 tip boxes) (VWR 53509-500)
  • PCR supermix - 4 boxes
  • E-gel 48 (G800801) - 5 boxes
  • E-gel 12-well (G501808) - 3 boxes
  • PCR supermix (6) 4/29
  • PCR supermix (6) 4/28
  • 6 - P-Touch Labels TZ241 (Black Print on White labels)
  • VWR Foil Seals - 60941-076 - 10 boxes (ordered 15)
  • 1.2ml MC Tips RT-L1200F - 2 boxes
  • Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
  • Ethanol 200 and 190 proof
  • Plasmid Prep Kit 10pc kit 2300210
  • Cardboard Boxes (MD664) (25per pack) - 5 packs for Teams, 8 packs for Labs
  • Bubble Wrap (Staples 468264) - 4 boxes for Labs
  • Packing Tape (Staples 473975) - 2 packs* TE - 17890 - 2 L
  • Invitrogen PCR SuperMix High Fidelity (10790-020) - 9 boxes
  • Primer for Linearized BB - gccgctgcagtccggcaaaaaaacg "SB-prep-3P"
  • Primer for Linearized BB - atgaattccagaaatcatccttagcg "SB-prep-2Ea"
  • Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
  • Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each) VWR 82030-992 (did 8 before)
  • Primer PBB-ior-R - tttgcaagcagcagattacg
  • Primer PBB-ior-F - tgaccaaaatcccttaacgtg
  • Primer PBB-eoro-R - gctgaagccagttaccttcg
  • Primer PBB-eoro-F - cgtcagaccccgtagaaaag
  • Primer PBB-TETR-R - ctcatgagcgcttgtttcg
  • Primer PBB-TETR-F - cgactcctgcattaggaagc
  • Primer PBB-KANR-R - cgctcgtcatcaaaatcactc
  • Primer PBB-KANR-F - tgttgatgcgctggcagt
  • Primer PBB-CMR-R - gggcgaagaagttgtccata
  • Primer PBB-CMR-F - cgatttccggcagtttctac
  • Primer PBB-AMPR-R - caacgttgttgccattgct
  • Primer PBB-AMPR-F - tctgacaacgatcggaggac
  • Primer PBB-AMPR-Long-F - gcggccaacttacttctgac
  • Primer PBB-CMR-Long-F - tacaccgttttccatgagca
  • Primer PBB-KANR-Long-F - gggaaaacagcattccaggt
  • Primer PBB-TETR-Long-R - cctatatcgccgacatcacc
  • Nunc 384 deep well plates - 269390 - 2 boxes VWR 73521-278
  • Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each) VWR 82030-992
  • Clear Plate Lids - 300 lids (VWR 73520-150, Nunc 250002)
  • 3M Micropore Tape (2 boxes)
  • Double Sided Foam Tape (10 rolls)
  • White Swan small women's Lab Coat (VWR# 80092-446)
  • Hand Soap (3 bottles)
  • 1ml epMotion Tip Racks - 960050088 - 2 boxes (ordered 3)
  • 48w E-gels - G8008-01 - 4 boxes
  • VF2/VR primers for Genewiz
  • Multi-channel Pipette: Pipet-Lite LTS 8-channel, 20 µl to 200 µl L8-200
  • Multi-channel Pipette: Pipet-Lite LTS 8-channel, 5 µl to 50 µl L8-50
  • SR-L250S Pipette Tips - 8 boxes (contains 5 tip racks each)
  • 10ul Tip Racks (SR-L10F) - 8 boxes (contains 5 tip racks each)
  • 1.2ml MC Tip Racks - RT-L1200F - 2 boxes
  • BSA - B9001S - 1 pack (4tubesx1.5ml)
  • NEB Buffer 2 - B7002S - 1 pack
  • 20ul Tips VWR - 2 boxes (14217-726)
  • 200ul Tips VWR - 2 boxes (14217-728)
  • 100 ml epMotion Reservoirs - 960051017 - 1 box
  • 1ml epMotion Tip Racks - 960050088 - 8 boxes
  • Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
  • 96 well Round Bottom Plates - 3958 - 2 boxes
  • 96 deep well Plates - 3960 - 4 boxes
  • Petri Dishes (2 boxes) 25384-250
  • Bleach
  • Inoculating Loops 12000-806
  • clear, skirted PCR Plate - 47744-124 - 4 boxes
  • Foil Covers - 60941-076 - 40 boxes
  • VWR reservoirs - 89094-658 2 boxes
  • TE (2 bottles) Thermo Scientific # 17890
  • Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
  • Corning 96-deepwell plates (3960) - 6 cs
  • VWR Autoclave bags 14220-042
  • Cresol Red Sigma-Aldrich 114480-5GM
  • 48 Well E-gels (Invitrogen G800801)
  • 10ul Tips - ART Reach (4 cases - 40 tip boxes) (VWR 53509-500)
  • clear, skirted PCR plate (1 box of 25) (47744-124)
  • LB Agar (9 bottles) (VWR 90003-112)
  • Petri Dishes (3000, 6 boxes of 500) (25384-250) -- only ordered 2 boxes
  • 20ul pipette tips (4 cases - 40 tip boxes) 14217-726
  • Reservoirs (2 boxes) (new #: 89094-658)
  • VWR Foil Seals (8 boxes of 50 seals) (VWR 60941-076)
  • Glass Beads (2 bottles) (VWR 26396-521)
  • Avery Easy Peel Address Labels (4 packs) (8160)
  • 10ul Tip Racks MC (SR-L10F) (4 cases - 20 tip boxes)
  • 250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
  • 1.2ml Tip Racks MC (RT-L1200F) (3 cases - 15 tip boxes)
  • 96 well Round Bottom Plates (2 boxes) (3958)
  • 96 well Deep Well Plates (2 boxes) (3960)
  • 1300 Cm Plates
  • 600 Amp Plates
  • Microflex Gloves (S, M, & L?) EV-2050-L
  • VWR Foil Seals (VWR 60941-076)
  • Perfect Prep Kit
  • Agar Broth/Plates
    • LB Agar (3 bottles) (VWR 90003-112)
    • Petri Dishes (1200 count at least) (25384-250)
    • SOB Media (1 bottle) (VWR 90003-336)
    • LB Broth (2 bottles) (VWR 90003-118)
    • Chloramphenicol (C0378-5G)
    • Ampicillin (A9518-25G)
    • Kanamycin (K1637-5G)
    • Tetracyclin (87128-25G)
    • 96 well Deep Well Plates (3960)
  • Restriction Digests
    • EcoRI
    • PstI
    • NEB Buffer 2
    • Hard Shell PCR Plates (twin.tec) (VWR 47744-124)
    • 48w E-gels
  • Pipette Tips
    • 10ul Tip Racks MC (SR-L10F)
    • 250ul Tip Racks MC (SR-L250S/F)
    • 1.2ml Tip Racks MC (RT-L1200F)
  • Brother TZ-241 Tape 3/4inch 18mm (White)
  • Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK)
  • Bubble Wrap
  • Perfectprep Plasmid 96 VAC 10/pk Kit
  • epTIPS 40-1000uL (Cat No. 960-05008-8)
  • epMotion Resevoir - 100mL (Cat No. 960051017)
  • epMotion Resevoir - 30mL
  • VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • Corning MiniPrep Assay Plates 2ml - 3960
  • VWR 200uL Barrier Tips (Cat No. 14217-728)
  • 10ul/20ul Tip Racks (SR-L10F)
  • 2.0mL Microtubes - (MCT-200-C-S)
  • Bleach
  • Corning 96w Clear Flatbottom Plates - 3651
  • 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
  • PCR Supermix
  • 12-well E-gels
  • Falcon 14ml Snap Cap Tubes (352059)
  • VWR Reagent Reservoirs (new #: 89094-658)
  • Glass beads (VWR 26396-521)
  • Aluminium Foil
  • 2-log Ladder from New England Biolabs #N3200L
  • EcoRI
  • NheI
  • Sigma Aldrich 123072-5G, Luminol, 5 gram (never received)
  • LB Agar
  • Nunc Ampule Boxes [Cartridges] #534479
  • Nalgene Cryoware, cryogenic vials
  • E-Gel 0.8% agarose, 18 per box, Cat no, G5018-08, Invitrogen
  • 2x 4 liter 10x TAE buffer
  • 2x QS710 gel casting tray with casting system, VWR IB51030
  • 5x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
  • 5x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
  • QS710 horizontal gel unit, VWR IB51000
  • 50 ml pipets
  • pack 500, Axygen 0.5 ml tubes, orange, SCT-050-SS-O VWR 10011-516
  • pack 500, Axygen 0.5 ml tubes, red, SCT-050-SS-R VWR 10011-520
  • pack 500, Axygen 0.5 ml tubes, green, SCT-050-SS-G VWR 10011-512
  • pack 500, Axygen 0.5 ml tubes, yellow, SCT-050-SS-Y VWR 10011-526
  • Ethanol (200 and 190 proof)
  • Promega Wizard SV96 PCR cleanup startup kit, Promega A6790, VWR PAA6790
  • Qiagen Miniprep kit-- down to last bag of columns and I will probably use them between this week and next week. . .
  • PCR SuperMix
  • NUNC Universal lids, sterile (VWR 73520-150, Nunc 250002)
  • twin.tec PCR plate 96, skirted (Eppendorf# 951020486, VWR# 47744-124)
  • Nunc Clear Lids (Universal) VWR 62409-118
  • VWR Reagent Reservoirs (new #: 89094-658)
  • 3m Micropore Tape
  • Falcon 14ml Snap Cap Tubes (352059)
  • case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
  • Adhesive Foil for Microplates (VWR Cat No. 60941-076)
  • Fireboy Butane Canisters (CV360) VWR 17919-890
  • 2x case 500, Axygen self-standing conical screw cap tubes, sterile, assorted colors, Axygen SCT-050-SS-A-S, VWR 10011-502
  • 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
  • 3x cases 200 ul pipet tips, VWR 14217-728
  • 3x cases 20 ul pipet tips, VWR 14217-726
  • 3x cases 1000XL pipet tips, VWR 87006-060
  • VF2 (for Vinoo)
  • VR (for Vinoo)
  • Suffix-F 5' A CTA GTA GCG GCC GCT GCA G 3' (for Vinoo)
  • Prefix-R 5' T CTA GAA GCG GCC GCG AAT TC 3' (for Vinoo)
  • 2 boxes 12 well 0.8% e-gels Invitrogen G5018-08
  • Sterile reagent reservoirs 100ml case 100 VWR 82026-358
  • 2x NEB DpnI R0176S
  • Replacement parts for Eppendorf rotor A-4-62, should be available through VWR
    • Eppendorf Replacement rubber mat, for 250 ml bucket adapters, set of 4 Eppendorf 022638483
    • 2x Replacement adapter clamp, for 250 ml bucket adapters, set of 2 Eppendorf 022638467
  • Difco LB Agar, Lennox
  • 10ul Multichannel pipette tips
  • Pack 16, TimeMed Indicator tape, 3/4" x 500", TimeMed TSI-534, VWR 14217-334
  • Pack 16, Time Tape Red,3/4 in, 500" long, VWR 36427-040
  • Pack 16, Time Tape Green,3/4 in, 500" long, VWR 36428-043
  • Pack 16, Time Tape Yellow,3/4 in, 500" long, VWR 36426-048
  • Pack 16, Time Tape Orange,3/4 in, 500" long, VWR 36427-506
  • Pack 12, Griffin Low Form Beakers, 1000 ml, polypropylene, Nalgene 1201-1000, VWR 13915-147
  • Beckman pH electrode, Epoxy, Semi-Micro, Gel-Filled, 6 x 150 mm, Beckman A51711, VWR BKA51711
  • 3/4" TZ Labelling Tape (White)
  • Case 72, Square polypropylene bottles, Narrow mouth, 30 ml, Nalgene 2016-0030, VWR 16120-732
  • 2x Qiagen Genomic Tip 500/G, catalog 10262, Genomic DNA maxiprep kit
  • 2x Qiagen Genomic DNA Buffer Set, catalog 19060
  • 2x bottles bleach
  • 1 case petri dishes
  • Case 72, Boston Round polypropylene bottles, Narrow mouth, 8 ml, Nalgene 2006-9025, VWR 16066-981
  • 2-hydroxy-propyl-beta-cyclodextrin Sigma H5784, 45% solution, 0.67 substitution, MW 1396
  • Sigma C8754-5g co-carboxylase, 5 grams
  • Sigma C3144-25mg Coenzyme A sodium salt, 25 mg
  • Sigma F6625-100mg FAD, 100 mg
  • Sigma N5755-100mg, NADH, 100 mg
  • Sigma G8645-25g, Sodium glucuronate, 25 g
  • Sigma A5960-25g, Ascorbic Acid, 25 g
  • Sigma B4501-1g, biotin, 1 g
  • Sigma P5710-25g, Calcium panothenate, 25 g
  • Sigma P1504-100ml, Tween-40, 100 ml
  • 48well E-Gel
  • Nitrile gloves, medium
  • Nitrile gloves, large
  • PCR SuperMix cat: 10790-20, 2x5 each Invitrogen
  • Sigma E6376 Erythromycin, 25 g
  • 2x bottles Difco LB Agar, Lennox
  • Petri Dishes w/ Ring (PD1905-500S) 2 boxes
  • 20ul Pipette Tips
  • 3x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
  • 3x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
  • 2x boxes E-Gels 12 well 0.8%
  • 20ul pipette tips
  • Axygen 2.0ml microtubes
  • Qiagen Miniprep Kit
  • Qiagen PCR Purification Kit
  • 14 ml Falcon Polypropylene Round-Bottom tube, cat. # 352059
  • Sybr Safe
  • 2x bottles Difco SOB Medium #244310, 500g
  • Qiagen
    • 9012595 Disposable Tips, 1100 ul (960)
    • 9012596 Disposable Tips, 300 ul (960)
  • From http://www.labarmor.com/ (use the two codes AUSTIN100 and A7780WT to get 5% off and free shipping)
    • Chill Bucket Kit SKU #67218-100
    • 8 Liters Bath Armor SKU #42370-008
  • Three boxes of NEB 10-beta competent cells - # C3019I
  • C-5097-100 ECOS 101 cells from http://www.bioexpress.com/index.html?wscdet_show=000000000150174000
  • case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
  • 3x SpeI NEB R0133S
  • 3x XbaI NEB R0145S
  • 2x pack 50 VWR electroporation cuvettes, 1 mm, VWR 89047-206
  • 3x cases 200 ul pipet tips, VWR 14217-728
  • 2x cases 12 Nalgene SFCA bottle top filters, 500 ml, VWR 291-4520
  • Fireboy Butane Canisters (CV360) VWR 17919-890
  • E-Gel 0.8% agarose (G5018-08), may want to order two-four boxes of these
  • Invitrogen PCR SuperMix High Fidelity (10790-020), may want to order two since have been disappearing at high rate; ordering a 5000 rxn kit would be best
  • invivogen LyoComp - E.coli GT116 lyo-116-11 http://www.invivogen.com/family.php?ID=189&ID_cat=7&ID_sscat=93#groupe204
  • Sigma B6650-10MG 5-Bromo-4-chloro-3-indolyl β-D-glucuronide cyclohexylammonium salt
  • Sigma S2647-100MG Spectinomycin dihydrochloride pentahydrate
  • Macherey-Nagel
  • Medium latex gloves
  • autoclave deodorizers (VWR 11214-703)
  • Three boxes of NEB 10-beta competent cells - # C3019I
  • 4x each of following
    • L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
    • L1004 - LB Agar Plates with Ampicillin-100. 100 mm Plates, sterile. 20 Pack.
    • L1017 - LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack.
    • L1232 - LB Agar Plates with Chloramphenicol-34, Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • 200ul pipette tips
  • 20ul pipette tips
  • Qiagen spin miniprep kit 250
  • Qiaex II gel purification kit
  • 48-well egels
  • 3x Drummond Portable Pipet-Aid rechargeable battery Drummond 4-000-035 VWR 53498-063
  • 10uL pippette tips
  • L5033 - LB Agar Plates with Tetracycline-15. 150 mm Plates, sterile. 20 Pack.
  • L5025 - LB Agar Plates with Kanamycin-50. 150 mm Plates, sterile. 20 Pack.
  • L5004 - LB Agar Plates with Ampicillin-100. 150 mm Plates, sterile. 20 Pack.
  • L5017 - LB Agar Plates with Chloramphenicol-34. 150 mm Plates, sterile. 20 Pack.
  • http://www.analytical-sales.com/
    • Cat #: 24108 - 24 well square well plate - 1 case
  • 6 sleeves LB-Tet plates from Teknova (VWR 100216-604)
  • 1 box 14 mL culture tubes
  • 48 well e-gels
  • 250ul Multi-Channel Tips (Rainin SR-L250S)
  • 5 boxes of NEB 10-beta competent cells - # C3019I
  • Three boxes of NEB 10-beta competent cells - # C3019I
  • NEB BstXI
  • XbaI
  • 20ul tips
  • Tet plates from Teknova
  • 2x boxes 12 well E-Gels
  • Glass beads (VWR 26396-521)
  • 2x NEB SpeI R0133S
  • 2x NEB EcoRI-HF R3101S
  • T4 DNA ligase (everyone seems to be out, order at least two aliquots?)
  • 3x NEB 10-beta competent cells - # C3019I
  • BioBrick assembly kit
  • Teknova plates for distribution
  • NUNC lids
  • L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack - 4 of these
  • reservoirs (VWR 82026-358)
  • http://www.analytical-sales.com/
    • minimum quantity of each of following
    • Cat #: 47025 - 24 column, low profile plate
    • Cat #: 96012 - 8 channel V-trough reservoir
    • Cat #: 24108 - 24 well square well plate
  • E-gels, .8% Agarose, 12 lane (down to last box, ~5 used already)
  • 10ul multi-channel pipet tips, there was only one left in the box today and I couldn't see any other boxes.
  • Nutrient Broth (Difco 234000)
  • Fireboy cartridges (VWR 17919-890)
  • 6x pairs of scissors (apparently someone eats them)
  • ATCC 49762 Providencia stuartii
  • 3 cases 50 ml serological pipets BD 357550 (VWR 53106-441)
  • 3 cases 10 ml serological pipets BD 357551 (VWR 53300-523)
  • 2x case 5 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul
  • 384-well plates (for Distribution)
  • LB Agar Lennox (VWR 90003-112)
  • 2x case 200 Autoclave bags, clear, VWR 14220-042
  • petri dishes (25384-250)
  • 10 ul tips (53509-500)
  • Bleach
  • lab notebooks (VWR TX126643MT)
  • EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
  • NEB 10-beta competent cells - # C3019I (order two boxes)
  • 2-log Ladder from New England Biolabs #N3200L
  • NEB M.EcoRI M0211S
  • NEB SbfI-HF R3642S
  • adhesive foil covers (for Distribution)
  • L1017 LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack - 8 of these (for postdocs)
  • PstI large
  • XbaI large
  • SpeI large (postdocs 3/11/09)
  • Invitrogen PCR Supermix Hi-Fi (postdocs, 3/11/09)
  • Qiagen QiaQuick PCR purification kit 250 - cat no. 28106
  • 96-well egels
  • 48-well egels
  • 20ul tips
  • 200ul tips
  • adhesive foil covers (VWR 60941-076)
  • Bio Rad Order # IC0282947
    • Biorad MLL-9601 - low profile unskirted natural pcr plates - ordered 1 pk
    • Biorad MSP-9601 - microseal skirted natural - ordered 2 pks
  • Millipore Millex-GV Filter unit 0.22 um pore size filters catalog no. SLGVR25LS (Req #11115919)
  • Microflex latex gloves small and large
  • 2 boxes of 12 well E-gels (Req #11121281)
  • Cartridges for Ptouch labeller. 18mm, 3/4", Black ink on white, TZ-241 TZ tape
  • GE templiphi 500 25-6400-50
  • Teknova plates: (ReqID #11115915)
    • Amp L1004
    • Amp-Cm L1243
    • Amp-Kan L1210
    • Amp-Tet L1216
    • Kan L1025
    • Cm L1017
  • NEB Order# 219818-OL
    • NEB - EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
    • NEB lambda exonuclease M0262S
    • NEB exonuclease III M0206S
    • NEB 10-beta competent cells - # C3019I (order two boxes)
  • Egels 12 well 0.8%
  • NEB 10-beta competent cells - # C3019I
  • 14 ml Polypropylene Round-Bottom Tube
  • mobio.com 12300-50 6 minute mini plasmid prep kit
  • ReqID 11110523:
  • Phusion™ High-Fidelity PCR Master Mix with HF Buffer catalog # F-531S
  • parafilm
  • 48 well e-gels
  • NEBbuffer 2 (unless we have a stash somewhere, we used 2 of 4 tubes in big -20)
  • NEB T4 DNA ligase
  • NEB 10-beta competent cells - # C3019I
  • Acinetobacter baylyi ATCC 33305
  • 2 cases petri dishes
  • ReqID 11106769
    • Fireboy gas canisters (VWR 17919-890)
    • adhesive foil covers (VWR 60941-076)
    • LB broth
  • NEB streptavidin magnetic beads S1420S
  • ReqID: 11105446
    • Invitrogen PCR Supermix High Fidelity (Invitrogen 10790-020)
  • 100 cylindrical 0.125x0.125 magnets
  • 100 cube 0.125 x 0.125 magnets
  • 50 cube 0.187x0.187 magnets
  • ReqID: 11104249
    • case N-DEX gloves, large
    • case N-DEX gloves, medium
    • cases of 10,20,200,and 1000 pippette tips (no full cases of any left, though there are a few boxes of the 1000s)
  • Invitrogen PCR SuperMix
  • Invitrogen ChargeSwitch CS10201 (for assembly)
  • Roche Protease Inhibitor, Complete Mini, EDTA-Free, 11836170001
  • Sigma D-7384-100G, Decanal
  • NEB EcoRI-HF R3101S
  • 2x boxes Invitrogen 12-well 0.8% E-Gels
  • Req ID: 11084279
    • 2 case petri dishes
    • GL45 media bottle caps, membrane, blue, Kimax 14395M45, VWR 89000-948, box 10
  • Qiagen miniprep kit --Meaganl 11:45, 21 November 2008 (EST)
  • NEB EcoRI R101S --Meaganl 11:45, 21 November 2008 (EST)
  • NEB T4 DNA ligase M0202S --Meaganl 11:45, 21 November 2008 (EST)
  • 3x Invitrogen NuPage sample reducing agent (10x) 250 ul, cat NP0004
  • L-Arabinose- A3256-100G Sigma
  • 3x Difco LB Agar, Lennox, 500g
  • 2x gal bleach
  • Difco Agar Noble 500g Ref 214230 (ON BACKORDER)
  • MRS broth, BD 288130, 500g VWR 90004-082 (Temporarily on backorder)
  • Case Microcentrifuge Tube Boxes, 1.5 ml, Nalge/Nunc 5055-5015, VWR 55710-175
  • NUNC 5-spot grey holder boxes VWR #534479
  • 20x Gibco yeast extract Cat. # 18180-059
  • Sigma C5080-500g Calcium chloride dihydrate, Sigma-Ultra
  • large latex gloves evolution one Reorder #: EV-2050-L
  • Case Kimwipes, EX-L
  • Sterile reagent reservoirs 100ml case 100 VWR 82026-358
  • 3x pack 300 disposable spatula, standard, opaque, VWR 80081-190
  • Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
  • Sigma M1633-1G 4-Methylumbelliferyl beta-D-galactopyranoside
  • 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
  • 2x EMD OmniPur Sucrose 500g
  • 3mm glass balls (for spreading transformed cells on plates)- no more left
  • Difco Heart Infusion Broth Ref. # 238400, 500 g
  • 1 case 10 Axygen MCT-200-C-S microtubes
  • 1 case 10 Axygen MCT-175-C-S microtubes

(Req ID: 11027695)

  • 2x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011)
  • nalgene cryoware cryogenic vials Cat #5000-0020 (last case, 2 bags left-order Thurs. July 10th if possible)
  • case BD 305491 5 gal sharps containers (VWR BD305491)
  • 2x pack 50 VWR electroporation cuvettes, 1 mm, VWR 89047-206
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • 14 mL culture tubes
  • case 1000 BD 352054 5ml culture tubes (VWR 60819-310)
  • case 72 VWR Traceclean 20 ml vials with fluoropolymer resin/silicone septum VWR 15900-008
  • case 72 Nalgene boston round bottles, 8 ml, polypropylene, NNI 2006-9025, VWR 16066-981
  • 2 cases 200 ul pipet tips, barrier, sterile, racked VWR 14217-728
  • NEB M0201S T4 polynucleotide kinase
  • 2 x TOP10 one-shot chemically competent cells SKU# C4040-03
  • Egel 12 lane gels .8 or 1%, only 5 or 6 are left
  • Qiagen RNeasy Protect Bacteria Mini Kit Cat. #74524
  • 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
  • Qiagen RNase-Free DNase Set Cat. #79254
  • ReqID: 11013874 (for PO)
    • 10x Rainin 250ul multichannel tips (SR-L250S)
    • 10x 1200ul multichannel tips
  • 2x DpnI from NEB (amount in -20 freezer restriction enzyme box is gone) Note: You can get the following free from NEB
  1. Receive a free Protein Ladder Sample with any purchase.
  • 2x NEB Phusion Flash high fidelity master mix F-548L (large version)
  • EMD OmniPur Sucrose 500g
  • 3M Micropore breathable cover for 96-well plates
  • 4x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011)
  • 2x Invitrogen S.O.C. medium 10x 1 ml, #15544-034
  • Costar 3370 (96 well flat bottom assay plate)
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
  • 2x Rainin 250ul multichannel tips (SR-L250S)
  • 2x 1200ul multichannel tips
  • NEB BfuCI R0636S
  • Sigma beta-galactosidase G4155-1KU
  • large latex gloves evolution one Reorder #: EV-2050-L
  • greiner 96-well plates catalog #T-3026-16
  • 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076 (ReqID: 11000465)
  • Invitrogen PCR SuperMix (only 2 tubes left) (ReqID: 11000464)
  • Rainin 250ul multichannel tips (SR-L250S)
  • 1200ul multichannel tips
  • ReqID: 10996069
    • Case 50, Greiner 2 ml clear Masterblock deep well plates, sterile, Greiner 780271, VWR 82051-248
    • 2x case 50, Nunc Microwell 96-well polystyrene plates, sterile, 0.3 ml, V-bottom, Nunc 249662, VWR 62409-112 (ON BACKORDER - SHIPPING 5/12)
    • 2x case 50, Nunc Microwell plate lids, sterile, cut off corners, Nunc 264122, VWR 62409-118 (ON BACKORDER - SHIPPING 5/6)
    • 2x case 500, Axygen self-standing conical screw cap tubes, sterile, assorted colors, Axygen SCT-050-SS-A-S, VWR 10011-502 (ON BACKORDER - SHIPPING 5/22)
  • 2x NEB Sau3AI R0169S (ON BACKORDER INDEFINITELY - DO YOU WANT TO CANCEL?)
  • Sciencelab 60-136380518 polyethylene fritware sheet, 70 micron, 18"x18" 1/8" thick
  • ReqID: 10913140
    • Daigger FX23461AX 96 well PCR racks, assorted colors, 4x pack 5 (on backorder --Meaganl 11:46, 27 August 2007 (EDT))
  • Get these Greiner plates instead: Endy:Victor3_plate_reader/Plates (catalog # T-3026-16) (reqID: 10996115)
  • 20x Invitrogen/Gibco yeast extract 18180-059 (ReqID# 10996112)
  • 6x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011) (Order # 107945)
  • 2x NEB Buffer 2 pack, B7002
  • Rainin 10ul multichannel tips (SR-L10S)
  • ReqID: 10996069
    • 3x Sterile reagent reservoirs 100ml case 100 VWR 82026-358
    • 3x Petri-stickers, Diversified Biotech PSTK-1050, [1]
    • 3x cases 200 ul pipet tips
    • 2x cases 20 ul pipet tips
    • 2x pack 50 VWR electroporation cuvettes, 1 mm, 89047-206
    • Difco Heart Infusion Broth, 238400, 500g
    • Difco/BD 220215 sterile disposable inoculating loop, 1 ul, 50/tube, pack 1000, VWR 90001-098
  • ReqID:
    • 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
    • Sigma I1284 IPTG
  • NEB protein ladder, P7703S
  • Rainin 250ul multichannel tips
  • 2x NEB DpnI R0176S
  • aluminum foil
  • 2x gal Pharmco ethanol, 190 proof
  • 2x gal Pharmco ethanol, 200 proof
  • 10x Invitrogen/Gibco Yeast extract solution, 100 ml, cat. 18180-059
  • pack 50 VWR electroporation cuvettes, 1 mm gap VWR 47727-640
  • pack 50 VWR electroporation cuvettes, 2 mm gap VWR 47727-642
  • 3x cases petri dishes
  • Axygen screw top microtubes, amber, 0.5 ml, self standing, ST-050-SS-X, VWR 10011-656, pack 500
  • 2x case 10 ml pipets
  • 2x case 25 ml pipets
  • 2x case 50 ml pipets
  • Pfu turbo DNA polymerase catalog no 600250 from Stratagene
  • Qiagen ERC MinElute cleanup kit large #28206
  • 20x Brother TZ-241 3/4" black on white label tape
  • Sigma M1633-250MG 4-Methylumbelliferyl beta-D-galactopyranoside
  • NEB PvuII R0151S
  • Sigma 43816-50ML, DTT, 1 M solution, 50 ML
  • Sigma D0632-10G, DTT, 10g
  • Invitrogen NuPage MOPS SDS running buffer, 20X, 500 ml, cat NP0001
  • Invitrogen NuPage LDS sample loading buffer (4x) 10 ml, cat NP0007
  • Invitrogen NuPage sample reducing agent (10x) 250 ul, cat NP0004
  • NEB Chitin beads S6651L (large version)
  • pack 50 VWR Signature electroporation cuvettes, 2mm gap, VWR 89047-208
  • sterile inoculating loops
  • NEB B0202S T4 DNA Ligase buffer pack (4x 1.5 ml buffer)
  • 2x Invitrogen NuPage 10% Bis-Tris Gels, 1.0mm x 9 well, cat NP0307BOX
  • ReqID: 10970539 (6)
    • 2x Difco SOB medium 244310, 500g (On backorder)
    • 4x gal bleach
  • Fermentas PpiI, cat #: ER1541, 50 units, $66
  • SibEnzyme MabI, cat #: E121, 200 units, $40
  • SibEnzyme PsrI, cat #: E131, 100 units, $50

(-Julie)

  • ReqID: 10975136
    • Molec bio grade ethanol (Sigma 7023-500ml)
  • ReqID: 10975027
    • (3) NUNC Universal lids, sterile (VWR 73520-150, Nunc 250002)
  • ReqID: 10974958
    • Qiaprep Spin Miniprep Kit (250), Cat. #27106
    • Reagent reservoirs
    • (5) Teknova Amp plates
  • ReqID: 10974975
    • GE(Amersham) templiphi 100
  • Epicentre EZ-Tn5 transposase
  • 2x case 12 Nalgene SFCA bottle top filters, 500 ml, VWR 291-4520
  • 10ul tips (VWR 53509-500)
  • NEB EcoRI
  • NEB XbaI
  • NEB T4 PNK M0201S
  • ReqID: 10968275
  • Sterile inoculating loops (VWR 12000-810)
  • Teknova AMP plates (VWR 100216-550)
  • Media cart for holodeck
  • ReqID: 10967075
    • Glycerol
    • Sigma C5080 Calcium Chloride dihydrate, 500g
  • ReqID: 10967081
    • Microgrip Nitrile Gloves (40101-346)
    • half-height round bottom 96-well plates - 3cs (82051-244)
  • ReqID: 10963590
    • Pierce 31503 Superfreeze peroxidase conjugate stabilizer, 25 ml
  • Costar 3960 (96 deep well culture plates)
  • 1 case 10 Axygen MCT-200-C-S microtubes
  • ReqID: 10963547
    • 0.8% 12 well e-gels from Invitrogen (G5018-08)
    • Invitrogen 10x TAE
  • ReqID: 10963590
    • 3x case 200 ul pipet tips (VWR 14217-728)
    • Falcon 14ml tubes 352059 (VWR 60819-761)
    • freezer boxes (w foam inserts) (Nalgene 5055-5015)
  • ReqID: 10963609
    • PBS (pH 7.4) 1L
  • EZ-Tn5 transposase
  • 1 case 10 Axygen MCT-060-C-S microtubes
  • 1 case 10 Axygen MCT-175-C-S microtubes
  • 3x case Nalgene Cryoware Cryo Vials, Cat # 5000-0020
  • 2x case 10 ml disposable pipets
  • 2x case 50 ml disposable pipets
  • ReqID: 10956768
    • Reagent reservoirs, VWR 82026-358
    • Teknova Amp plates (L1004)
    • 4 bottles LB agar (240110)
    • Spiral bound computation books (lab notebooks). Ampad #22-157. VWR TX126643MT
    • Autoclave bags, 25" x 35", VWR 14220-042
    • Petri dishes, two cases (25384-250)
  • ReqID: 10954559
    • Invitrogen PCR Supermix
  • 10 ul tips
  • --Meaganl 13:43, 9 January 2008 (CST)
    • Req ID: 10949471
      • 2x Sucrose, EMD Omnipure, 500 g
    • 20x Brother TZ-241 3/4" black on white label tape
    • Req ID: 10949254
      • Difco 0142 Agar Noble, 500g
      • 2 dozen Campingaz / Coleman CV360 butane canisters (for Fireboy) VWR 17919-890
      • 1000ul tips
    • Pierce EZ-link Psoralen-PEO-biotin, 5 mg #29986
    • Pierce Streptavidin Horseradish peroxidase conjugated, 1 mg, # 21126 (in -20)
    • Pierce Immunopure biotinylated horseradish peroxidase, 5 mg, # 29139
    • Pierce One-step Ultra TMB-substrate, 250 ml # 34028
    • Pierce Ultralink immobilized streptavidin, 2 ml, # 53113
    • Req ID: 10949274
      • Sigma M0262 Methylcellulose viscosity 400 cP, 2 % in H2O, 100g
      • Sigma E5529 EZ-view red streptavidin affinity gel, 1 ml
    • case BD sharps collector 3.1 liter BD 305488
    • Qiagen ERC MinElute cleanup kit large #28206
  • Req ID: 10937895
    • Nitric acid, concentrated, 1 liter
  • NEB BsmBI R0580S
  • ReqID: 10946402
    • Invitrogen Sybr Safe
  • ReqID: 10946457
    • Sigma Aldrich 151238 Glycidyl methacrylate 5 grams
    • Sigma B9300 Benzophenone 500 grams
    • Sigma Aldrich 311448 Sodium periodate 5 grams
    • Sigma S4762 Streptavidin 1 milligram
    • Sigma T4174 10×, 5.0 g porcine trypsin and 2 g EDTA • 4Na per liter of 0.9% sodium chloride 100 ml
    • Sigma T4799 Trypsin from procine pancreas 5 grams
    • Sigma T9003 Type I-S Trypsin inhibitor, lyophilized powder (Sigma), 100 milligrams
  • 200ul tips
  • ReqID: 10943944
    • 5x horse serum, Sigma
  • 10x Invitrogen/Gibco Yeast extract solution, 100 ml, cat. 18180-059
  • ReqID: 10943885
    • Qiaprep Spin Miniprep Kit (250), Cat. #27106
  • 8 strip ultra clear caps Cat No TCS-0803 clear from MJ Research (now BioRad - same cat. number)
  • Low tube strip, CLR from BioRad catalog no. TLS0801 (please buy equal numbers as caps
  • Rainin SR-L250S multichannel tips (250 uL capacity)
  • Harris Uni-Core punches, 0.35, 0.50, 0.75, 1.0 mm, four each, Ted Pella
  • Hydrochloric acid, concentrated, 1 liter
  • EZ-Tn5 transposase, Epicentre, EZ-Tn5
  • Req ID: 10937925
    • 6x Horse Serum, Donor Herd, Sigma H1138, 500 ml
  • 200μL multichannel tips from Rainin
  • Acetic acid, glacial, 1 liter
  • ReqID: 10936396
    • 2x case 5 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul
    • large latex gloves evolution one Reorder #: EV-2050-L
    • Difco LB Agar, Lennox, 500g
  • 1 box Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • multichannel 10ul tips Rainin SR-L10F
  • Ptouch label supplies 3/4in white background, black ink - TZ-241
  • Zymo ZR96 genomic DNA kit, 4 x 96 well plates D3011, Zymo site
  • Amylose resin from NEB (Catalog no. E8021S) --Reshma 14:38, 25 November 2007 (CST)
  • NEB PstI
  • P1000 tips
  • Qiaprep Spin Miniprep Kit (250), Cat. #27106 (only 10 or so columns left may want to order before Thurs)
  • Qiagen Qiaex II Gel Extraction Kit, Cat. #20051
  • NEB MboI (large) R0147L
  • 1 NEB T4 DNA Ligase M0202S (need before Thursday)
  • Invitrogen Sybr Safe
  • ReqID: 10930951
    • Case Microcentrifuge Tube Boxes, 1.5 ml, Nalge/Nunc 5055-5015, VWR 55710-175
    • 2x case 12 Nalgene 291-4520 SFCA Bottle Top Filter 75mm dia filter, 45 mm cap, VWR 28199-307
    • 3x Novagen Pellet Paint NF #70748 (available through VWR)
    • 2x case Nalgene cryo vials Nalgene 5000-0020
  • Sau3AI, NEB R0169S
  • PvuII, NEB R0151S
  • Phusion HF master mix, NEB F531S
  • pack 50 VWR Signature electroporation cuvettes, 2mm gap, VWR 89047-208
  • ReqID: 10923808
  • EZ-Tn5 transposase, Epicentre, EZ-Tn5
  • Req ID: 10920911
    • VWR 12x75mm polypropylene round bottom sterile tubes Cat No 60818-576
    • BD Falcon 352054 5ml polystyrene falcon tube
    • 2x cases 50 ml plug seal centrifuge tubes, sterile, racked (VWR 20171-028 --Meaganl 12:31, 17 October 2007 (CDT))
    • 2x cases 15 ml plug seal centrifuge tubes, sterile, racked (VWR 20171-024 --Meaganl 12:31, 17 October 2007 (CDT))
    • 2x 1/4 oz. Immersion oil type DF low fluorescence, CARGILLE LABORATORIES, VWR 48218-506
  • VWR 33725-042 Glas-Col Mini-rotator (099A-MR1512) 120v (another one, now that we know they work well)
  • 2x boxes 12 well 0.8% agarose E-Gels
  • exo I M0293S
  • DpnI R0176S
  • ReqID: 10915844
    • Sodium deoxycholate from Sigma 30970-25G
  • MboI NEB R0147S
  • 2x cases Petri dishes
  • Pack 768 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul (on backorder)
  • Daigger FX4727A 250 ml polypropylene centrifuge tubes, 250 ml, Pack 12 (on backorder --Meaganl 11:46, 27 August 2007 (EDT))
  • VWR 33725-042 Glas-Col Mini-rotator (099A-MR1512) 120v (On backorder until 9/24) --Meaganl 14:45, 20 September 2007 (EDT)
  • ReqID: 10906942
    • Falcon 14ml tubes 352059 (3 boxes, we go through them fast)
    • 3x Drummond Portable Pipet-Aid rechargeable battery Drummond 4-000-035 VWR 53498-063
    • case 12, Nalgene MF75 Bottle top vacuum filters, Surfactant free CA, 500 ml, 0.20 micron, NNI 291-4520, VWR 28199-307
    • ART 10ul tips
    • Pack 768 VWR 87006-058 Barrier tips, sterile, 250 ul
  • 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • 6x Invitrogen/Gibco Yeast extract, 100 ml, cat. 18180-059
  • ReqID: 10904172
    • Roche Dig-High Prime DNA labeling and detection starter kit II for chemiluminescent detection cat 11 585 614 910
    • Roche Digoxigenin-11-dUTP, alkaline labile 25 nmol, cat 11 573 152 910
  • ReqID: 10904145
    • BD 35 2059 polypropylene round bottom tubes, 14 ml, 17 x 100 mm
  • ReqID: 10904171
    • Sigma 77617 Fluka Biochimika ultra Phenol Chloroform Isoamyl alcohol mixture 25:24:1, 100 ml
  • ReqID:10898629
  • Pierce B-PER bacterial protein extraction reagent 500 ml #78248
  • Req ID: 10901718
  • Invitrogen UltraPure Agarose 15510-027
  • Invitrogen Sybr Safe
  • ReqID: 10901688
    • 3x pack 1000 MCT-060-C-S
    • 1x case 10 MCT-175-C-S
    • 1x case 10 MCT-200-C-S
    • 2x pack 100 Axygen Cyclerseal PCR-TS, VWR 10011-120
    • case 36 BD 353226 24 well plates, 6/bag, VWR 62406-159
  • NEB P8101S Modified Trypsin
  • NEB S6651S Chitin beads
  • NEB M0280S UDG
  • Roche Complete mini EDTA free protease inhibitor cocktail, glass vial 25 tablets, 11 836 170001 --Meaganl 10:12, 4 September 2007 (EDT)
  • 3x Crane's Thesis Paper100% Cotton, Acid Free, 500 sheets (SKU BT886S)
  • Daigger FX28271J 6x10 4 mil polyethylene bags, case 1000
  • recombinant EGFP 100ug (Order # 120924)
  • Nalgene Cryoware Cryo Vials, Cat # 5000-0020 --Meaganl 10:50, 22 August 2007 (EDT)
  • 2x VWR 55411-050 single edge razor blades, pack 100 --Meaganl 10:50, 22 August 2007 (EDT)
  • Qiagen miniprep kit
  • Sap1 restriction enzyme
  • 95% ethanol
  • 100x Olfa Green Mat, 6" x 8
  • 6x Invitrogen 18180-059 Yeast extract solution --Meaganl 14:05, 14 August 2007 (EDT)
  • 2x Invitrogen E-Gel .8% Agarose, Cat #G5018-08 --Meaganl 14:05, 14 August 2007 (EDT)
  • Pfu turbo DNA polymerase catalog no 600250 (100 U) from Stratagene.--Meaganl 14:05, 14 August 2007 (EDT)
  • 100x Harris Uni-core punch, disposible, 2mm
  • Req ID: 10893241
    • 2x pack 50 VWR Signature electroporation cuvettes, 1mm gap, VWR 47727-640 --Meaganl 11:49, 14 August 2007 (EDT)
  • Topoisomerase 1 from E. coli 100 units catalog # M0301S
  • Epicentre EZ-Tn5 transposase TNP92110, 10 units
  • Req ID: 10890897
    • 3x cases 20 ul tips
    • 3x cases 200 ul tips
    • 3x cases 1000 ul tips
  • Invitrogen Sybr Safe
  • Harris Uni-core punch, disposible, 2mm
  • C. S. Osborne Belt punches, sizes 00, 0, 1, 2
  • Olfa Green Mat, 6" x 8"
  • Ptouch 3/4" white black ink labelling supplies TZ-241 (10x)
  • Qiagen Minelute PCR Cleanup Kit (250) # 28006
  • 2-log Ladder (from New England Biolabs) #N3200L
  • Invitrogen E-gel-48
  • NuPAGE® Novex 4-12% Bis-Tris Gel 1.0 mm, 12 well NP0322BOX - 1 box
  • Req ID 10887733
    • Spiral bound computation books (lab notebooks). Ampad #22-157. VWR TX126643MT
    • 100ml reservoirs VWR 82026-358
    • Falcon 14ml tubes 352059
    • Nalgene blue 16mm test tube racks (for holding 14ml tubes)- 60914-730
  • Req ID: 10886117
    • Difco LB Agar Lennox Ref. 240110
  • Foil adhesive covers (60941-074)
  • 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • ReqID: 10883548
    • 2x cases petri dishes
    • 2x cases 12 Nalgene 290-4520 SFCA bottle top filter, 150ml, 45mm neck, 50 mm membrane, 0.2u filter
    • 2x PstI R0140S
    • Robot: SpeI
  • ReqID: 10878908
    • Bleach
  • multichannel 10ul tips Rainin SR-L10F
  • VF2 and VR Primers
  • Robot: 30ml and 100ml reservoirs
  • Alconox Alcojet dishwashing detergent (let me know if you need a catalog no.)
  • ReqID: 10874005
    • Sigma C7901-25G Chelex 100
  • SeeBlue® Plus2 Pre-Stained Standard - Invitrogen Catalog Number - LC5925
  • Robot: Invitrogen E-gel 48
  • MicroAmp™ Optical 96-Well Reaction Plate (Part# N8010560) - 10 Plate Package
  • 2x E-Gel 0.8% agarose (GP) #G5018-08
  • ReqID: 10871228
    • TempliPhi 100 Amplification Kit
  • NEB phi29 DNA polymerase M0269S
  • Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
  • T4 endo VII http://www.mclab.com/product.php?productid=18100&cat=292&page=1
  • TDG H00006996-Q01 http://www.novusbio.com/data_sheet/index/H00006996-Q01
  • NEB BbsI R0539S
  • Robot: Sigma ATP (3x)
  • 1 500 mL bottle of Ethyl acetate catalog # MK499204 at VWR
    • BD Falcon 352063 (VWR 60819-728)
    • 14 mL culture tubes Falcon 352059 (VWR 60819-761)
  • DNA Topoisomerase I, Vaccinia (500 U)
  • Propidium iodide Invitrogen P1304MP
  • NuPAGE® Sample Reducing Agent (10X) NP0004
  • NuPAGE® Novex 4-12% Bis-Tris Gel 1.0 mm, 12 well NP0322BOX
  • Immobilized Streptavidin Pierce #20349 (VWR # PI20349)
  • 100 ml multi-well pipettor reservoirs
  • Spherotech ACFP-100-3 AccuCount Fluorescent Particles 8.0-12.9 µm, 3 mL
  • 3x Novagen Pellet Paint NF #70748 (available through VWR)
  • Qiagen miniprep spin kit (250) # 27106
  • Qiagen Minelute PCR Cleanup Kit (250) # 28006
  • NEB M0302S endo I
  • NEB M0305S endo V
  • (2cs) Petri dishes
  • Sigma M2128 Thiazolyl Blue Tetrazolium 500 mg
  • K3007 N-(β-Ketocaproyl)-L-homoserine lactone from Sigma
  • polypropylene tubes VWR catalog# 60818-576
  • Spherotech RCP-60-5 calibration beads
  • 8 well strip tubes, clear, low profile
  • 1 case of 10ul tips (not via requisition; on CC)
  • Req ID: 10855012 Ampicillin salt (Sigma A9518)
  • Req ID: 10854533 TempliPhi 100 (Amersham/GE Healthcare)
  • 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
  • Req ID: 10854540
    • two dozen black ultra-fine point Sharpies
  • Req ID: 10854530
    • case BD 305491 5 gallon sharps containers
    • case Nalgene 5055-5015 microcentrifuge box, 64 places, foam insert
    • 2 cs 10ul tips
    • 6 cs 20ul tips
    • 3 cs 200ul tips
    • 3 cs 1000ul tips
  • scotch tape. The rolls that can be put in existing dispensers.
  • large latex gloves
  • Mermaid kit, 200 preps, [2]
  • Geneclean III kit, 600 preps, [3]
  • (3) NEB T4 DNA Ligase M0202S
  • NEB phi29 DNA polymerase M0269S
  • ReqID 10851873
    • Sigma D157805-5G N,N'-dimethylethylenediamine
  • Invitrogen Sybr Safe
  • PO# 10847064
    • Nonidet-P40 substitute Sigma 74385-1L
    • Tween-20 Sigma P7949-100ML
    • Tween-40 Sigma P1504-100ML
    • Tween-80 Sigma P8074-100ML
  • Glycerol (Sigma G6279) -- on backorder
  • 1.7mL clear sterile tubes (Reshma) --Meaganl 09:43, 12 April 2007 (EDT)
  • Reshma 09:41, 19 March 2007 (EDT): Cartridges for Ptouch labeller. 18mm, 3/4", Black ink on white, TZ-241 TZ tape
  • Trevigen TDG 4070-500-EB
  • Trevigen MutY 4000-500-K
  • Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
  • Beckman reference solution 4M KCl, 4 x 100 ml, 566468 VWR BK566068
  • --Meaganl 14:44, 3 April 2007 (EDT)
    • Reshma 11:55, 23 March 2007 (EDT): SpeI
    • NEB EarI (yes again) R0528S
    • NEB endo IV M0304S
    • NEB endo VIII M0299S
  • Qiagen miniprep kit (large)--Meaganl 10:32, 3 April 2007 (EDT)
  • Immobilized Streptavidin Pierce #20349 (VWR # PI20349) --Meaganl 13:42, 26 March 2007 (EDT)
  • Reshma 11:23, 19 March 2007 (EDT): Nalgene cryovials
  • Reshma 17:06, 8 March 2007 (EST): 14 mL culture tubes Falcon 352059
  • Reshma 13:44, 8 March 2007 (EST): Difco LB Lennox Broth
  • NEB BsmBI R0580S --Meaganl 10:41, 22 March 2007 (EDT)
  • Ambion superase-in #2694 --Meaganl 15:16, 15 March 2007 (EDT)
  • Reshma: Qiagen ERC MinElute cleanup kit large #28206
  • Reshma: PCR supermix
  • --Meaganl 11:05, 9 March 2007 (EST)
    • case BD sharps collector 3.1 liter 305488
    • case standard petri dishes 100 x 15 mm VWR # 25384-250
    • 3x bottles bleach
    • 4 cases 1000 ul barrier pipet tips VWR 14217-730
    • 4 cases 200 ul barrier pipet tips VWR 14217-728
    • 3 cases 50 ml serological pipets BD 357550
    • 3 cases 10 ml serological pipets BD 357551
    • 1 case 25 ml serological pipets BD 357525
  • NEB phi29 DNA polymerase M0269S --Meaganl 16:29, 8 March 2007 (EST)
  • NEB BbsI R0539S --Meaganl 16:29, 8 March 2007 (EST)
  • NEB EarI R0528S --Meaganl 16:29, 8 March 2007 (EST)
  • Invitrogen Sybr Safe --Meaganl 16:27, 6 March 2007 (EST)
  • NEB T4 DNA ligase large (M0202L) PO# 0010830023 --Meaganl 08:49, 2 March 2007 (EST)
  • VWR 3 1/2 mm glass beads 1lb pack 26396-521 (PO# 10826298) tk 15:32, 26 February 2007 (EST)
  • Invitrogen E-Gels, 0.8% EtBr, Single comb, pack 18, G5018-08 tk 15:32, 26 February 2007 (EST)
  • PO #10825054
    • Sigma Aldrich Tetracycline BioChemika 87128-25G tk 15:32, 26 February 2007 (EST)
    • Sigma Aldrich Chloramphenicol BioChemika 23275-25G tk 15:32, 26 February 2007 (EST)
    • Sigma Aldrich Kanamycin K1637-5G tk 15:32, 26 February 2007 (EST)
  • PO# 10823861
    • GE Healthcare Sephacryl S-500 HR 150 ml, Cat 17-0613-01 VWR 95016-920 tk 15:32, 26 February 2007 (EST)
    • GE Healthcare Sephacryl S-400 HR 150 ml, Cat 17-0609-01 VWR 95016-912 tk 15:32, 26 February 2007 (EST)
    • GE Healthcare Sephacryl S-300 HR 150 ml, Cat 17-0599-01 VWR 95016-908 tk 15:32, 26 February 2007 (EST)
  • Polybead polystyrene red dyed microspheres, 0.2 micron, 2.5% aqueous solution, smallest amount tk 15:32, 26 February 2007 (EST)
    • Order # 47T9282PPGGQ8LDHCRF9WDNN82
  • PO#10822102
    • Sucrose, Omnipure, EMD, VWR #EM-8510, 500g
  • PO#10822065
    • 3x pack 300 disposable spatula, standard, opaque, VWR 80081-190
    • NEB BsmBI
    • 2x NEB 2-log ladder, large N3200L
  • P-10 tips (2 cases) --Meaganl 09:44, 2 February 2007 (EST)
  • Multichannel 1200ul pipette tips --Meaganl 09:44, 2 February 2007 (EST)
  • Bio-rad PCR strip tubes #TLS0801 (5 boxes) tk 19:13, 31 January 2007 (EST)
  • NEB β Agarase I M0392S --Meaganl 14:37, 31 January 2007 (EST)
  • Epicentre CircLigase #CL4111K --Meaganl 13:36, 30 January 2007 (EST)
  • Micropure EZ columns Catalogue Number: 42530 from Millipore (shipped on 1/26)--Meaganl 13:36, 30 January 2007 (EST)
  • Shipped on 1.26 --Meaganl 14:22, 29 January 2007 (EST)
    • Qiagen RNase-free Dnase set Cat #79254
    • Qiagen RNeasy minelute cleanup Cat #74204
    • Qiagen ERC MinElute cleanup kit #28204
  • EDTA disodium salt for molecular biology 500g Sigma E5134 --Meaganl 09:48, 24 January 2007 (EST)
  • Sigma S7547-1Kg D-Sorbitol Sigmaultra --Meaganl 09:48, 24 January 2007 (EST)
  • Sigma M6880-25G (malachite green oxalate salt) --Meaganl 09:48, 24 January 2007 (EST)
  • DEPC - 25mL (Sigma) --Meaganl 09:48, 24 January 2007 (EST)
  • 2x packs 100, BD Syringe 3 ml Luer Lok, BD 309585 --Meaganl 09:48, 24 January 2007 (EST)
  • NEB N0345S Yeast Chromosome PFG Marker --Meaganl 21:36, 23 January 2007 (EST)
  • NEB N0340S Lambda ladder PFG Marker --Meaganl 21:36, 23 January 2007 (EST)
  • PMSF 100 mM in ethanol 50 ml Biochemika 93482 --Meaganl 14:56, 22 January 2007 (EST)
  • N-lauroyl sarcosine sodium salt 30% solution 100 ml Biochemika 61747 --Meaganl 14:56, 22 January 2007 (EST)
  • 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250 --Meaganl 14:56, 22 January 2007 (EST)
  • 4L cubetainer of 10x TBE buffer VWR EM-8820 --Meaganl 14:56, 22 January 2007 (EST)
  • ClaI NEB R0197S --Meaganl 14:56, 22 January 2007 (EST)
  • P-10 tips --Meaganl 14:56, 22 January 2007 (EST)
  • 2 4L cubetainers of 10X TAE buffer Invitrogen #15558-026 --Meaganl 11:48, 18 January 2007 (EST)
  • SYBR gold (Invitrogen catalog number S-11494) --Meaganl 11:48, 18 January 2007 (EST)
  • Invitrogen Sybr Safe --Meaganl 11:48, 18 January 2007 (EST)
  • Nunc Deepwell 384-well plates
  • EcoR1, small (Robot)
  • SpeI, large (Robot) x2
  • PstI, small (Robot)
  • Eppendorf Robot Miniprep kits x2 --Reshma 15:17, 10 January 2007 (EST)
  • XbaI --Reshma 15:17, 10 January 2007 (EST)
  • Difco LB Agar, Lennox--Meaganl 10:39, 9 January 2007 (EST)
  • illustra TempliPhi 100 Amplification Kit (Amersham/GE Healthcare) tk 22:01, 22 December 2006 (EST)
  • 200 ul pipet tips (3 cases)--Meaganl 07:46, 21 December 2006 (EST)
  • 20 ul pipet tips (2 cases)--Meaganl 07:46, 21 December 2006 (EST)
  • 1000 ul pipet tips (3 cases)--Meaganl 07:46, 21 December 2006 (EST)
  • Falcon 14ml tubes 352059--Meaganl 07:46, 21 December 2006 (EST)
  • AG 501-X8(D) Resin, molecular biology grade, 100 g, catalog number 143-6425 from Bio-Rad--Meaganl 07:46, 21 December 2006 (EST)
  • Sigma Molecular Bio Grade 200 proof ethanol--Meaganl 10:12, 20 December 2006 (EST)
  • RNaseZap wipes (Ambion AM9786)--Meaganl 10:12, 20 December 2006 (EST)
  • Alpha Innotech (replacement) EtBr filter EBR-500K
  • Qiagen miniprep kit (2 of these I believe) --Reshma 13:52, 9 December 2006 (EST)
  • Eppendorf 30ml robot reagent reservoirs --Meaganl 14:22, 3 December 2006 (EST)
  • 100ml sterile reagent reservoirs--Meaganl 11:26, 1 December 2006 (EST)
  • (VWR) Nalgene microcentrifuge tube boxes (case)--Meaganl 11:26, 1 December 2006 (EST)
  • Plastic disposible cuvettes, OPS, 10x10x45 mm, 2 optical surfaces, VWR 58017-825, case 500--Meaganl 11:26, 1 December 2006 (EST)
  • Plastic disposible cuvettes, OPS, 10x4x45 mm, 2 optical surfaces, VWR 58017-847, case 500--Meaganl 11:26, 1 December 2006 (EST)
  • Difco Bacto Agar 0140-01--Meaganl 11:26, 1 December 2006 (EST)
  • Sigma L5263-25KU, Lyticase from Arthrobacter luteus, partially purified--Meaganl 15:33, 30 November 2006 (EST)
  • Sigma 73660-5G Biochemika 99%+ 2-nitrophenyl β-D-galactopyranoside (ONPG)--Meaganl 15:44, 29 November 2006 (EST)
  • SpeI NEB R0133S--Meaganl 15:04, 28 November 2006 (EST)
  • NotI NEB R0189S--Meaganl 15:04, 28 November 2006 (EST)
  • β-Agarase I NEB M0392S--Meaganl 15:04, 28 November 2006 (EST)
  • Sigma 43816-50ml DL Dithiothreitol solution 1M Biochemika ultra -- tk 14:18, 27 November 2006 (EST)
  • Sigma S7547-1Kg D-Sorbitol Sigmaultra --Meaganl 11:30, 27 November 2006 (EST)
  • Sigma D5545-1G DL Dithiothreitol Sigmaultra --Meaganl 11:30, 27 November 2006 (EST)
  • Brother Labeler 18mm 3/4" black ink on white tape --Meaganl 10:06, 27 November 2006 (EST)
  • Nalgene microcentrifuge tube boxes (only got 4 boxes) --Meaganl 11:22, 20 November 2006 (EST)
  • BD 60ml syringes --Meaganl 11:22, 20 November 2006 (EST)