BME100 f2013:W900 Group6 L6: Difference between revisions
| Line 58: | Line 58: | ||
* Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC | * Cancer-specific Reverse Primer: GGTCCTAAAAACTCTTACAC | ||
How the primers work: It beings with identifying the "target sequence," in this case the cancer-associated SNP rs17879961 . The primers bind specifically to the 3' end of the target sequence. Note that, primers will only bind to the sequences that are only complimentary to their own sequence. The primers then direct a DNA polymerase to synthesize the complementary DNA strands. Only DNA with the target sequence will be copied | How the primers work: It beings with identifying the "target sequence," in this case the cancer-associated SNP rs17879961 . The primers bind specifically to the 3' end of the target sequence. Note that, primers will only bind to the sequences that are only complimentary to their own sequence. The primers then direct a DNA polymerase to synthesize the complementary DNA strands. Only DNA with the target sequence will be copied, because DNA polymerase can only copy the molecules with the primer attached; this is the reason non-cancer alleles will not be amplified. | ||
With each PCR cycle partially target sequences and double stranded molecules which contain only the target sequence are “created” (also known as “amplified”). As the cycles continue, more target sequences of double stranded molecules (with the target sequence: rs17879961) and partial target sequences are produced. Consequently, with each PCR cycle the number of strands with the target sequence grows exponentially. Essentially, after all cycles are complete, the end results will be a large number of pure target sequence molecules that only code for the SNP rs17879961 cancer-associated marker. | With each PCR cycle partially target sequences and double stranded molecules which contain only the target sequence are “created” (also known as “amplified”). As the cycles continue, more target sequences of double stranded molecules (with the target sequence: rs17879961) and partial target sequences are produced. Consequently, with each PCR cycle the number of strands with the target sequence grows exponentially. Essentially, after all cycles are complete, the end results will be a large number of pure target sequence molecules that only code for the SNP rs17879961 cancer-associated marker. | ||
Revision as of 06:03, 26 November 2013
| Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | ||||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD On November 20th we worked with the Tinkercad tool in which we designed each of the past tools that we have used in our labs. We used the tinkercad tool to better the PCR Tubes, the Open PCR machine, the phone holder for the Fluorimeter and the packaging for these devices. First we worked on the PCR Tubes "Blacking them out" in order to prevent things from bleaching such as the SYBR green in the previous lab, we also added markings on the side in order to see the measurements in the tube. We also designed some of the packaging for the device as well as the PCR machine which was more of a software fix than an actual design flaw.
One possible way to use tinkerCAD for something practical is the camera holder. What tinkerCad allows us to do is design an object easily and is a free tool so we can design a project without the need to buy materials and supplies and prototype the design. When the model is completed tinkerCAD also allows us to print off the design with the use of a 3D printer. We came up with the design for the camera holder because the one used in the previous lab would not hold the phone in an upright position because it was not adjustable to the phone we used, we developed a new design for the holder by making it adjustable and easy to figure out and use.
Feature 1: Cancer SNP-Specific PrimersBackground on the cancer-associated mutation
How the primers work: It beings with identifying the "target sequence," in this case the cancer-associated SNP rs17879961 . The primers bind specifically to the 3' end of the target sequence. Note that, primers will only bind to the sequences that are only complimentary to their own sequence. The primers then direct a DNA polymerase to synthesize the complementary DNA strands. Only DNA with the target sequence will be copied, because DNA polymerase can only copy the molecules with the primer attached; this is the reason non-cancer alleles will not be amplified. With each PCR cycle partially target sequences and double stranded molecules which contain only the target sequence are “created” (also known as “amplified”). As the cycles continue, more target sequences of double stranded molecules (with the target sequence: rs17879961) and partial target sequences are produced. Consequently, with each PCR cycle the number of strands with the target sequence grows exponentially. Essentially, after all cycles are complete, the end results will be a large number of pure target sequence molecules that only code for the SNP rs17879961 cancer-associated marker. Feature 2: Consumables KitIn our kit we will be including the PCR tubes, the PCR tube container as well as holder, the newly designed camera/phone stand for the fluorimeter, as well as a micropipetor along with tips for the micropipetor.
Feature 3: PCR Machine HardwareThe PCR Machine will be used in the same way as it was set up during the previous lab, the only difference would be the logging software used during the process. The PCR machine will duplicate the DNA strands in order to detect the cancer segment of the DNA, by denaturing the DNA with high temperatures, once the DNA is separated annealing begins and primers are attached to the DNA segments, thus synthesizing complementary strands of DNA and held at a constant temperature to ensure the DNA is extended completely. It was noted that one of the weakness for the PCR machine was that it didn't have a way of logging/recorded data, during the time that the machine was running. Our team is going to address this problem by creating a communication connection between the data of the PCR machine to a computer. We will be doing this by adding a logging program and USB connection to the PCR machine that will automatically start and record all data being given off by the PCR machine. Feature 4: Fluorimeter HardwareWe did not change the fluorimeter, the only thing we changed with that setup was the actual camera/phone holder, we made it adjustable so the device could be placed in an upright position.
Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic ApproachCalculation 3 is the positive predictive value: the probability that a cancerous patient will test positive with the PCR-based diagnostic test. The percent value for calculation 3 is a small value and has low specificity, telling us that there are a number of results that came back as false-positives. This informs us that some patients are non-cancerous but came back with a positive test result from the PCR-based diagnostic test. Calculation 4 is the negative predictive value: the probability that a non-cancerous patient will test negative with the PCR-based diagnostic test. The percent value for calculation 4 is close to one and has high sensitivity, suggesting that this test is a good standard. |
||||||




