BME100 f2013:W1200 Group6 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 60: Line 60:


==Feature 2: Consumables Kit==
==Feature 2: Consumables Kit==
 
<br>
''[Instructions: Summarize how the consumables will be packaged in your kit. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look awesome and easy to score.]''<br>
<BR>
<BR>
We will use a cardboard box with a styrofoam block in the inside to safely protect the materials. The micropipette, primer and mix will be held in place so that it will not move during packaging. Also, there will be plastic baggies to hold the tubes so that the kit is neatly organized and nothing gets mixed around. On the side of the styrofoam box will be the instructions manual. The outside of the box will have pictures that will demonstrate its uses and make it look professional.
We will use a cardboard box with a styrofoam block in the inside to safely protect the materials. The micropipette, primer and mix will be held in place so that it will not move during packaging. Also, there will be plastic baggies to hold the tubes so that the kit is neatly organized and nothing gets mixed around. On the side of the styrofoam box will be the instructions manual. The outside of the box will have pictures that will demonstrate its uses and make it look professional.

Revision as of 05:43, 27 November 2013

BME 100 Fall 2013 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR COMPANY

Jenny Chen
Tracy Lopez
Nayobe Bivins
Alex Bugarin
Nicholas Kilpatrick

LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

TinkerCAD is an online site that allows the user to create 3D designs easily. By combining and manipulation basic shapes, any design can be created. There are special tools and shapes that allow the user to create precise details. Once designed, it can be sent to a 3D printer to get a physical model by using a standard STL file. We used TinkerCAD to modify a set of tubes used in PCR.


The tubes were modified to include thin rubber strips around each tube for easier gripping. This would prevent slipping while handling the tubes. The tubes are also labelled in order to help with tube identification. The back of the rubber strip was left blank so that you could label with additional information if needed.


Implications of Using TinkerCAD for Design

One possible redesign of the OpenPCR machine would be to design a better camera holder. We had a lot of difficulty keeping the camera in one place. It was very easy to bump it and then everything would have to be set up again.

Using TinkerCAD, one could attach the camera holder to the fluorometer. This attachment could be adjustable to allow the camera holder to be placed in the correct position to focus. Once in the correct position, a knob would hold the assembly in place so that the camera holder would stay in place.



Feature 1: Cancer SNP-Specific Primers

Background on the cancer-associated mutation
Carbohydrates, proteins, and lipids form the central structure of the working part of most cells. However, they do not have control over the operation of the cells. This responsibility is done by four main groups of biological molecules called nucleic acids. The dsDNA (double-stranded deoxyribonucleic acid) is responsible for carrying, encoding, and passing the genetic information from one generation to another. The dsDNA is classified as a polymer; that is, it is made up of subunits (called monomers) joined together to make larger molecules. The monomers that make up the dsDNA are called the nucleotides. A nucleotide is made up of three components that are linked together: a phosphate group, a five-carbon sugar molecule (this differentiates dsDNA from the single-stranded RNA), and a nitrogen base (adenine, thymine, guanine, and cytosine). The base pairing of the nucleotides are always complementary. This means that adenine (A) will only pair with thymine (T), and guanine (G) will only bind with cytosine (C). For example, if the DNA sequence of the leading strand is AGCTTGGTACCAGC, then the DNA sequence of the complementary strand should be TCGAACCATGGTCG. For this reason, they dictate the order of the nucleotides being synthesized on the new DNA strand during the replication process.

A genome is an organism's entire genetic makeup. The human genome is composed of billions of base pairs. When the genome is copied to make a new cell it is not always perfect because a single base pair may: get deleted, added, or substituted. An example of this is when one DNA sequence is CTAAGTA and the other DNA sequence is CTAGGTA (this sequence should be CTAAGTA). The two DNA sequences seem identical; however, they differ at one nucleotide position. Variation or mutation in a single base pair creates a single nucleotide polymorphism (SNP). Our DNA is actually made up of millions of SNPs; this accounts for the many differences (e.g. physical characteristics, development of diseases or our systems’ response to pharmaceutical drugs) we have to each other.

Furthermore, the SNP rs17879961 is linked to a high risk of cancers to homo sapiens. It commonly occurs on chromosome number 22 with a clinical significance of a pathogenic allele (i.e. it is in the human gene checkpoint kinase 2 or also called CHEK2). The CHEK2 gene provides codes for making proteins called checkpoint kinase 2. Checkpoint kinase 2 is stimulated when the dsDNA is damaged for whatever reason (e.g. disturbance of homeostasis). Ultimately, it acts as a tumor suppressor by inhibiting cancer cells from rapidly dividing and affecting healthy cells.

Primer design

  • Forward Primer: 5' - TGTAAGGACAGGACAAATTT
  • Cancer-specific Reverse Primer: 5' - TGGGTCCTAAAAACTCTTAC

How the primers work:
With the patient’s sample in the solution, the reverse primer will bind to the complementary cancer-SNP template. The reverse primer will only bind to its complementary sequence. The reverse primer and the complementary sequence must match or it will not bind. The forward primer acts in the same manner. It will only bind if it matches its complementary sequence. If either primer does not match the sequence completely, it will not bind at all. If it does not match, then it will not replicate. Therefore, only the DNA with the cancer-associated SNP will be replicated. Any DNA containing the non-cancer allele will not be replicated. In this lab, the primers will amplify only the DNA that contains the cancer-associated SNP rs17879961.


Feature 2: Consumables Kit



We will use a cardboard box with a styrofoam block in the inside to safely protect the materials. The micropipette, primer and mix will be held in place so that it will not move during packaging. Also, there will be plastic baggies to hold the tubes so that the kit is neatly organized and nothing gets mixed around. On the side of the styrofoam box will be the instructions manual. The outside of the box will have pictures that will demonstrate its uses and make it look professional.

Weaknesses in the last kit was that the SYBR green dye kept going faulty. The SYBR green dye needs to be kept out of the light. We made the SYBR green tubes black so that light will not degrade the dye. Another weakness was the labeling of the microtubes. We made the tubes better by adding labels to the side of the tubes. These labels not only identified the tubes, but also used as a grip so it does not fall from your fingertips on accident.

Feature 3: PCR Machine Hardware

The pcr machine is newly improved and will be able to test more samples at once. The machine will run more smmothly and will be able to run the cycles simultaneously on the open PCR program. This will make the machine a lot more time effecient and it will allow hospitals to do more tests at once for a high demand of samples.


A weakness when using the open pcr machine is that it was not fast enough and that it did not do enough PCR tests at once. Also that it only tuke 16 samples for 2 hours. So what we decided to do was to add mor sample holders on the machine. By making a double open pcr machine that can hold two seperate pieces of samples. This way the machine will be doing double the work in only half of the time. This can also help seperating your samples and making sure of knowing where the samples were left. Next the machine had to be connected to the computer to be able to use the computer to access the information on the PCR Machine. To fix that we added a USB port that a USB can be plugged in to. When the machine says complete on the LED screen, that information is transferred onto the flash drive. This flash drive can be plugged into any computer to have the information readily available.



Feature 4: Fluorimeter Hardware

The fluorimeter will be using its same methods when its incorporated in the system design. It will still detect DNA in the our system and transmit light that will detect a fluoresence for a concentration of DNA. Though the added changes to the Fluorimeter will make it more effecient and easier to use. Such as adding grips and connecting the cradle to the fluorimeter box.



First when redesigning the Fluorimeter box there will be grips placed on the bottom of the box. So it will have the whole botoom covered with material that will not let the box move as easily. Then it will also have an additional adjustible plate that will connect from the fluorimeter box to the cradle that holds the phone. This will help with the problem of having to adjust the distance every time the Fluorimeter is used with the same phone. Also there will be an app on a the apple or android market specifically for the Fluorimeter Hardware. The app will have camera application and when it is opened it will be set to the most optimized setting for taking pictures of the DNA. When the pictures are taken they can be automatically uploaded wirelessly to the computer ready for imageJ. This will reduce the time of uploading photos and making the Fluorimeter more effecient.



Weaknesses:
1. The Fluorimeter was not very stable when adjusting the slides and it made the fluorimeter move very easily.
2. Tedious and took to long to analyze the data.


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach


Calculation 3 gives the probability that a patient will develop cancer, given a cancerous DNA sequence. Our result from calculation 3 was very small. This implies that the CHEK2 PCR is not accurate. It is unable to predict if a patient possessing the cancerous DNA sequence will develop cancer. The PCR analysis will generally not return a positive result from cancerous DNA.

Calculation 4 tests specificity. It analyzes the probability that the patient will not develop cancer, given a non-cancer DNA sequence. Our result from calculation 4 was larger than calculation 3, but still not close to 1. So, a non-cancerous DNA would often still return a positive result.