IGEM:IMPERIAL/2006/project/primers/Cre Lox: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 10: | Line 10: | ||
*We need both the sense strand and the anti-sense strand for this primer | *We need both the sense strand and the anti-sense strand for this primer | ||
**31bp into part B0021 (long due to a run of T and A) | **31bp into part B0021 (long due to a run of T and A) | ||
** | **22bp into part I13521 | ||
Sense Strand : | |||
cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc | cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc | ||
Antisense Strand: | |||
GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG | GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG | ||
| Line 24: | Line 24: | ||
'''Primer 3''' | '''Primer 3''' | ||
*Primer 3 contans a section | *Primer 3 contans a section complementary to the sense strand of the construct and a Lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it. | ||
CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC | CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC | ||
Revision as of 15:11, 28 October 2006
Primer 1
- Primer 1 is the same as the sense streand and consists of
- Restriction Sites – Lox Site – Stop Codon – First 20 bases of part B0021
GAATTCGCGGCCGCTTCTAGAGCGATAACTTGGTATAGCATACATTATACGAACGGTATGAAAATAATAAAAAAGCGG
Primer 2
- We need both the sense strand and the anti-sense strand for this primer
- 31bp into part B0021 (long due to a run of T and A)
- 22bp into part I13521
Sense Strand :
cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc
Antisense Strand:
GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG
Primer 3
- Primer 3 contans a section complementary to the sense strand of the construct and a Lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.
CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC
For further information on incorporation [here]