IGEM:IMPERIAL/2006/project/primers/Cre Lox: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Jonny (talk | contribs)
No edit summary
Jonny (talk | contribs)
No edit summary
Line 10: Line 10:
*We need both the sense strand and the anti-sense strand for this primer
*We need both the sense strand and the anti-sense strand for this primer
**31bp into part B0021 (long due to a run of T and A)
**31bp into part B0021 (long due to a run of T and A)
**22Bp into part I13521
**22bp into part I13521




Same as Sense Strand :  
Sense Strand :  


cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc
cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc


Reversed And Complemantry
Antisense Strand:


GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG
GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG
Line 24: Line 24:
'''Primer 3'''
'''Primer 3'''


*Primer 3 contans a section complemantry to the sense strand of the construct and a lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.
*Primer 3 contans a section complementary to the sense strand of the construct and a Lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.
 


CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC
CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC

Revision as of 15:11, 28 October 2006

Primer 1

  • Primer 1 is the same as the sense streand and consists of
    • Restriction Sites – Lox Site – Stop Codon – First 20 bases of part B0021

GAATTCGCGGCCGCTTCTAGAGCGATAACTTGGTATAGCATACATTATACGAACGGTATGAAAATAATAAAAAAGCGG

Primer 2

  • We need both the sense strand and the anti-sense strand for this primer
    • 31bp into part B0021 (long due to a run of T and A)
    • 22bp into part I13521


Sense Strand :

cggattaataatctggctttttatattctcttataaacgcagaaaggcccacc

Antisense Strand:

GGTGGGCCTTTCTGCGTTTATAAGAGAATATAAAAAGCCAGATTATTAATCCG


Primer 3

  • Primer 3 contans a section complementary to the sense strand of the construct and a Lox site and some restriction sites. It was made by copying the end of the desired sense strand and making it complementary and reversing it.


CTGCAGCGGCCGCTACTAGTAATAACTTCGTATAATGTATCGTATACGAACGGTAACTCCCTATCAGTGATAGAGATTGACATCC


For further information on incorporation [here]