Knight:Orders: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| (23 intermediate revisions by 2 users not shown) | |||
| Line 6: | Line 6: | ||
==Needs to be Ordered== | ==Needs to be Ordered== | ||
*Lithium Energizer Batteries (50) | |||
*Labels TZe-231 1/2in tape (8) | |||
==Placed Orders== | ==Placed Orders== | ||
* Labels TZ-241 White - 18 cassettes | |||
* Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK) 8 Packs | |||
* Packing tape | |||
* 500ml Vacuum Filters (VWR 28199-307) - 1 Box | |||
* Nunc - Ampule Boxes - 534479 - 1 Case (350 per) | |||
* Falcon 14ml Snap Cap Tubes (352059) | |||
* Rechargeable NiMH Battery - 53498-063 VWR (for Pipet-aid) (2) | |||
==Received Orders== | |||
<small>(Please make sure to update this or tell Meagan if you receive an order -- and make sure to save the packing slip)</small> | |||
{{hide|1= | |||
* 384 well Nunc Plate w/ Lid (VWR 82030-992) - 12 boxes of 100 each | |||
* 30ml epMotion Reservoirs (Cat No. 960051009) - 2 boxes | |||
* Cresol Red (114480-5GM) - 2 bottles (10g total) | |||
* PCR SuperMix High Fiedlity (6 boxes) | |||
* NALGENE cryoware cryogenic vials Cat #5000-0020 - 1 Case (sent incorrect type) | |||
* NUNC Universal Lids (VWR 73520-150, Nunc 250002) - 2 Boxes | |||
* Adhesive Foil (60941-076) - 30 boxes of 50 each | |||
* 50ml Conical Tubes (Corning 430290 or VWR 20171-028) - 1 Case | |||
* Red Skirted PCR Plates (Cat No. 951020486) - 2 boxes | |||
* TE (17890) - 2L | |||
*250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes) | |||
*VWR reservoirs - 89094-658 2 boxes | |||
*Wizard® SV 96 PCR Clean-Up System (A9342) from Promega | |||
*Invitrogen CC | |||
**48-well e-gels (1 box) | |||
**PCR supermix (1 box) | |||
*10ul Tips - ART Reach (4 PACKS (not cases) - 40 tip boxes) (VWR 53509-500) | *10ul Tips - ART Reach (4 PACKS (not cases) - 40 tip boxes) (VWR 53509-500) | ||
* PCR supermix - 4 boxes | * PCR supermix - 4 boxes | ||
| Line 18: | Line 47: | ||
* 6 - P-Touch Labels TZ241 (Black Print on White labels) | * 6 - P-Touch Labels TZ241 (Black Print on White labels) | ||
* VWR Foil Seals - 60941-076 - 10 boxes (ordered 15) | * VWR Foil Seals - 60941-076 - 10 boxes (ordered 15) | ||
* 1.2ml MC Tips RT-L1200F - 2 boxes | * 1.2ml MC Tips RT-L1200F - 2 boxes | ||
* Nunc - Ampule Boxes - 534479 - 1 Case (350 per) | * Nunc - Ampule Boxes - 534479 - 1 Case (350 per) | ||
Latest revision as of 15:59, 11 August 2011
<html><style type='text/css'> .tabs {
width: 750px; font-family: trebuchet ms;
}
.tabs strong{
color: #602;
} </style></html>
Orders will be placed every Thursday unless otherwise requested.
Needs to be Ordered
- Lithium Energizer Batteries (50)
- Labels TZe-231 1/2in tape (8)
Placed Orders
- Labels TZ-241 White - 18 cassettes
- Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK) 8 Packs
- Packing tape
- 500ml Vacuum Filters (VWR 28199-307) - 1 Box
- Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
- Falcon 14ml Snap Cap Tubes (352059)
- Rechargeable NiMH Battery - 53498-063 VWR (for Pipet-aid) (2)
Received Orders
(Please make sure to update this or tell Meagan if you receive an order -- and make sure to save the packing slip)
- 384 well Nunc Plate w/ Lid (VWR 82030-992) - 12 boxes of 100 each
- 30ml epMotion Reservoirs (Cat No. 960051009) - 2 boxes
- Cresol Red (114480-5GM) - 2 bottles (10g total)
- PCR SuperMix High Fiedlity (6 boxes)
- NALGENE cryoware cryogenic vials Cat #5000-0020 - 1 Case (sent incorrect type)
- NUNC Universal Lids (VWR 73520-150, Nunc 250002) - 2 Boxes
- Adhesive Foil (60941-076) - 30 boxes of 50 each
- 50ml Conical Tubes (Corning 430290 or VWR 20171-028) - 1 Case
- Red Skirted PCR Plates (Cat No. 951020486) - 2 boxes
- TE (17890) - 2L
- 250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
- VWR reservoirs - 89094-658 2 boxes
- Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
- Invitrogen CC
- 48-well e-gels (1 box)
- PCR supermix (1 box)
- 10ul Tips - ART Reach (4 PACKS (not cases) - 40 tip boxes) (VWR 53509-500)
- PCR supermix - 4 boxes
- E-gel 48 (G800801) - 5 boxes
- E-gel 12-well (G501808) - 3 boxes
- PCR supermix (6) 4/29
- PCR supermix (6) 4/28
- 6 - P-Touch Labels TZ241 (Black Print on White labels)
- VWR Foil Seals - 60941-076 - 10 boxes (ordered 15)
- 1.2ml MC Tips RT-L1200F - 2 boxes
- Nunc - Ampule Boxes - 534479 - 1 Case (350 per)
- Ethanol 200 and 190 proof
- Plasmid Prep Kit 10pc kit 2300210
- Cardboard Boxes (MD664) (25per pack) - 5 packs for Teams, 8 packs for Labs
- Bubble Wrap (Staples 468264) - 4 boxes for Labs
- Packing Tape (Staples 473975) - 2 packs* TE - 17890 - 2 L
- Invitrogen PCR SuperMix High Fidelity (10790-020) - 9 boxes
- Primer for Linearized BB - gccgctgcagtccggcaaaaaaacg "SB-prep-3P"
- Primer for Linearized BB - atgaattccagaaatcatccttagcg "SB-prep-2Ea"
- Wizard® SV 96 PCR Clean-Up System (A9342) from Promega
- Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each) VWR 82030-992 (did 8 before)
- Primer PBB-ior-R - tttgcaagcagcagattacg
- Primer PBB-ior-F - tgaccaaaatcccttaacgtg
- Primer PBB-eoro-R - gctgaagccagttaccttcg
- Primer PBB-eoro-F - cgtcagaccccgtagaaaag
- Primer PBB-TETR-R - ctcatgagcgcttgtttcg
- Primer PBB-TETR-F - cgactcctgcattaggaagc
- Primer PBB-KANR-R - cgctcgtcatcaaaatcactc
- Primer PBB-KANR-F - tgttgatgcgctggcagt
- Primer PBB-CMR-R - gggcgaagaagttgtccata
- Primer PBB-CMR-F - cgatttccggcagtttctac
- Primer PBB-AMPR-R - caacgttgttgccattgct
- Primer PBB-AMPR-F - tctgacaacgatcggaggac
- Primer PBB-AMPR-Long-F - gcggccaacttacttctgac
- Primer PBB-CMR-Long-F - tacaccgttttccatgagca
- Primer PBB-KANR-Long-F - gggaaaacagcattccaggt
- Primer PBB-TETR-Long-R - cctatatcgccgacatcacc
- Nunc 384 deep well plates - 269390 - 2 boxes VWR 73521-278
- Nunc 384 well plates w lid - 265202 - 8 boxes (100plates in each) VWR 82030-992
- Clear Plate Lids - 300 lids (VWR 73520-150, Nunc 250002)
- 3M Micropore Tape (2 boxes)
- Double Sided Foam Tape (10 rolls)
- White Swan small women's Lab Coat (VWR# 80092-446)
- Hand Soap (3 bottles)
- 1ml epMotion Tip Racks - 960050088 - 2 boxes (ordered 3)
- 48w E-gels - G8008-01 - 4 boxes
- VF2/VR primers for Genewiz
- Multi-channel Pipette: Pipet-Lite LTS 8-channel, 20 µl to 200 µl L8-200
- Multi-channel Pipette: Pipet-Lite LTS 8-channel, 5 µl to 50 µl L8-50
- SR-L250S Pipette Tips - 8 boxes (contains 5 tip racks each)
- 10ul Tip Racks (SR-L10F) - 8 boxes (contains 5 tip racks each)
- 1.2ml MC Tip Racks - RT-L1200F - 2 boxes
- BSA - B9001S - 1 pack (4tubesx1.5ml)
- NEB Buffer 2 - B7002S - 1 pack
- 20ul Tips VWR - 2 boxes (14217-726)
- 200ul Tips VWR - 2 boxes (14217-728)
- 100 ml epMotion Reservoirs - 960051017 - 1 box
- 1ml epMotion Tip Racks - 960050088 - 8 boxes
- Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
- 96 well Round Bottom Plates - 3958 - 2 boxes
- 96 deep well Plates - 3960 - 4 boxes
- Petri Dishes (2 boxes) 25384-250
- Bleach
- Inoculating Loops 12000-806
- clear, skirted PCR Plate - 47744-124 - 4 boxes
- Foil Covers - 60941-076 - 40 boxes
- VWR reservoirs - 89094-658 2 boxes
- TE (2 bottles) Thermo Scientific # 17890
- Plasmid Prep Kit 10pc kit 2300210 - need 3 kits
- Corning 96-deepwell plates (3960) - 6 cs
- VWR Autoclave bags 14220-042
- Cresol Red Sigma-Aldrich 114480-5GM
- 48 Well E-gels (Invitrogen G800801)
- 10ul Tips - ART Reach (4 cases - 40 tip boxes) (VWR 53509-500)
- clear, skirted PCR plate (1 box of 25) (47744-124)
- LB Agar (9 bottles) (VWR 90003-112)
- Petri Dishes (3000, 6 boxes of 500) (25384-250) -- only ordered 2 boxes
- 20ul pipette tips (4 cases - 40 tip boxes) 14217-726
- Reservoirs (2 boxes) (new #: 89094-658)
- VWR Foil Seals (8 boxes of 50 seals) (VWR 60941-076)
- Glass Beads (2 bottles) (VWR 26396-521)
- Avery Easy Peel Address Labels (4 packs) (8160)
- 10ul Tip Racks MC (SR-L10F) (4 cases - 20 tip boxes)
- 250ul Tip Racks MC (SR-L250F) (3 cases - 15 tip boxes)
- 1.2ml Tip Racks MC (RT-L1200F) (3 cases - 15 tip boxes)
- 96 well Round Bottom Plates (2 boxes) (3958)
- 96 well Deep Well Plates (2 boxes) (3960)
- 1300 Cm Plates
- 600 Amp Plates
- Microflex Gloves (S, M, & L?) EV-2050-L
- VWR Foil Seals (VWR 60941-076)
- Perfect Prep Kit
- Agar Broth/Plates
- LB Agar (3 bottles) (VWR 90003-112)
- Petri Dishes (1200 count at least) (25384-250)
- SOB Media (1 bottle) (VWR 90003-336)
- LB Broth (2 bottles) (VWR 90003-118)
- Chloramphenicol (C0378-5G)
- Ampicillin (A9518-25G)
- Kanamycin (K1637-5G)
- Tetracyclin (87128-25G)
- 96 well Deep Well Plates (3960)
- Restriction Digests
- EcoRI
- PstI
- NEB Buffer 2
- Hard Shell PCR Plates (twin.tec) (VWR 47744-124)
- 48w E-gels
- Pipette Tips
- 10ul Tip Racks MC (SR-L10F)
- 250ul Tip Racks MC (SR-L250S/F)
- 1.2ml Tip Racks MC (RT-L1200F)
- Brother TZ-241 Tape 3/4inch 18mm (White)
- Padded Envelopes 6" x 10", 25/Pack (Staples Item 558320 Model B83125PK)
- Bubble Wrap
- Perfectprep Plasmid 96 VAC 10/pk Kit
- epTIPS 40-1000uL (Cat No. 960-05008-8)
- epMotion Resevoir - 100mL (Cat No. 960051017)
- epMotion Resevoir - 30mL
- VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
- Corning MiniPrep Assay Plates 2ml - 3960
- VWR 200uL Barrier Tips (Cat No. 14217-728)
- 10ul/20ul Tip Racks (SR-L10F)
- 2.0mL Microtubes - (MCT-200-C-S)
- Bleach
- Corning 96w Clear Flatbottom Plates - 3651
- 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
- PCR Supermix
- 12-well E-gels
- Falcon 14ml Snap Cap Tubes (352059)
- VWR Reagent Reservoirs (new #: 89094-658)
- Glass beads (VWR 26396-521)
- Aluminium Foil
- 2-log Ladder from New England Biolabs #N3200L
- EcoRI
- NheI
- Sigma Aldrich 123072-5G, Luminol, 5 gram (never received)
- LB Agar
- Nunc Ampule Boxes [Cartridges] #534479
- Nalgene Cryoware, cryogenic vials
- E-Gel 0.8% agarose, 18 per box, Cat no, G5018-08, Invitrogen
- 2x 4 liter 10x TAE buffer
- 2x QS710 gel casting tray with casting system, VWR IB51030
- 5x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
- 5x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
- QS710 horizontal gel unit, VWR IB51000
- 50 ml pipets
- pack 500, Axygen 0.5 ml tubes, orange, SCT-050-SS-O VWR 10011-516
- pack 500, Axygen 0.5 ml tubes, red, SCT-050-SS-R VWR 10011-520
- pack 500, Axygen 0.5 ml tubes, green, SCT-050-SS-G VWR 10011-512
- pack 500, Axygen 0.5 ml tubes, yellow, SCT-050-SS-Y VWR 10011-526
- Ethanol (200 and 190 proof)
- Promega Wizard SV96 PCR cleanup startup kit, Promega A6790, VWR PAA6790
- Qiagen Miniprep kit-- down to last bag of columns and I will probably use them between this week and next week. . .
- PCR SuperMix
- NUNC Universal lids, sterile (VWR 73520-150, Nunc 250002)
- twin.tec PCR plate 96, skirted (Eppendorf# 951020486, VWR# 47744-124)
- Nunc Clear Lids (Universal) VWR 62409-118
- VWR Reagent Reservoirs (new #: 89094-658)
- 3m Micropore Tape
- Falcon 14ml Snap Cap Tubes (352059)
- case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
- Adhesive Foil for Microplates (VWR Cat No. 60941-076)
- Fireboy Butane Canisters (CV360) VWR 17919-890
- 2x case 500, Axygen self-standing conical screw cap tubes, sterile, assorted colors, Axygen SCT-050-SS-A-S, VWR 10011-502
- 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250
- 3x cases 200 ul pipet tips, VWR 14217-728
- 3x cases 20 ul pipet tips, VWR 14217-726
- 3x cases 1000XL pipet tips, VWR 87006-060
- VF2 (for Vinoo)
- VR (for Vinoo)
- Suffix-F 5' A CTA GTA GCG GCC GCT GCA G 3' (for Vinoo)
- Prefix-R 5' T CTA GAA GCG GCC GCG AAT TC 3' (for Vinoo)
- 2 boxes 12 well 0.8% e-gels Invitrogen G5018-08
- Sterile reagent reservoirs 100ml case 100 VWR 82026-358
- 2x NEB DpnI R0176S
- Replacement parts for Eppendorf rotor A-4-62, should be available through VWR
- Eppendorf Replacement rubber mat, for 250 ml bucket adapters, set of 4 Eppendorf 022638483
- 2x Replacement adapter clamp, for 250 ml bucket adapters, set of 2 Eppendorf 022638467
- Difco LB Agar, Lennox
- 10ul Multichannel pipette tips
- Pack 16, TimeMed Indicator tape, 3/4" x 500", TimeMed TSI-534, VWR 14217-334
- Pack 16, Time Tape Red,3/4 in, 500" long, VWR 36427-040
- Pack 16, Time Tape Green,3/4 in, 500" long, VWR 36428-043
- Pack 16, Time Tape Yellow,3/4 in, 500" long, VWR 36426-048
- Pack 16, Time Tape Orange,3/4 in, 500" long, VWR 36427-506
- Pack 12, Griffin Low Form Beakers, 1000 ml, polypropylene, Nalgene 1201-1000, VWR 13915-147
- Beckman pH electrode, Epoxy, Semi-Micro, Gel-Filled, 6 x 150 mm, Beckman A51711, VWR BKA51711
- 3/4" TZ Labelling Tape (White)
- See http://www.concordsupplies.com/brother-tz-241-tape-cartridge-brother-tz241/45224.html
- Also note bundle of 36 available
- Case 72, Square polypropylene bottles, Narrow mouth, 30 ml, Nalgene 2016-0030, VWR 16120-732
- 2x Qiagen Genomic Tip 500/G, catalog 10262, Genomic DNA maxiprep kit
- 2x Qiagen Genomic DNA Buffer Set, catalog 19060
- 2x bottles bleach
- 1 case petri dishes
- Case 72, Boston Round polypropylene bottles, Narrow mouth, 8 ml, Nalgene 2006-9025, VWR 16066-981
- 2-hydroxy-propyl-beta-cyclodextrin Sigma H5784, 45% solution, 0.67 substitution, MW 1396
- Sigma C8754-5g co-carboxylase, 5 grams
- Sigma C3144-25mg Coenzyme A sodium salt, 25 mg
- Sigma F6625-100mg FAD, 100 mg
- Sigma N5755-100mg, NADH, 100 mg
- Sigma G8645-25g, Sodium glucuronate, 25 g
- Sigma A5960-25g, Ascorbic Acid, 25 g
- Sigma B4501-1g, biotin, 1 g
- Sigma P5710-25g, Calcium panothenate, 25 g
- Sigma P1504-100ml, Tween-40, 100 ml
- 48well E-Gel
- Nitrile gloves, medium
- Nitrile gloves, large
- PCR SuperMix cat: 10790-20, 2x5 each Invitrogen
- Sigma E6376 Erythromycin, 25 g
- 2x bottles Difco LB Agar, Lennox
- Petri Dishes w/ Ring (PD1905-500S) 2 boxes
- 20ul Pipette Tips
- 3x boxes Biorad flat caps for 8 strip PCR tubes, Biorad TCS-0803
- 3x boxes Biorad 8 strip PCR tubes, 0.2 ml, Biorad TBS-0201
- 2x boxes E-Gels 12 well 0.8%
- 20ul pipette tips
- Axygen 2.0ml microtubes
- Qiagen Miniprep Kit
- Qiagen PCR Purification Kit
- 14 ml Falcon Polypropylene Round-Bottom tube, cat. # 352059
- Sybr Safe
- 2x bottles Difco SOB Medium #244310, 500g
- Qiagen
- 9012595 Disposable Tips, 1100 ul (960)
- 9012596 Disposable Tips, 300 ul (960)
- From http://www.labarmor.com/ (use the two codes AUSTIN100 and A7780WT to get 5% off and free shipping)
- Chill Bucket Kit SKU #67218-100
- 8 Liters Bath Armor SKU #42370-008
- Three boxes of NEB 10-beta competent cells - # C3019I
- C-5097-100 ECOS 101 cells from http://www.bioexpress.com/index.html?wscdet_show=000000000150174000
- case Axygen 1.7ml Clear Sterile Microtubes (MCT-175-C-S)
- 3x SpeI NEB R0133S
- 3x XbaI NEB R0145S
- 2x pack 50 VWR electroporation cuvettes, 1 mm, VWR 89047-206
- 3x cases 200 ul pipet tips, VWR 14217-728
- 2x cases 12 Nalgene SFCA bottle top filters, 500 ml, VWR 291-4520
- Fireboy Butane Canisters (CV360) VWR 17919-890
- E-Gel 0.8% agarose (G5018-08), may want to order two-four boxes of these
- Invitrogen PCR SuperMix High Fidelity (10790-020), may want to order two since have been disappearing at high rate; ordering a 5000 rxn kit would be best
- invivogen LyoComp - E.coli GT116 lyo-116-11 http://www.invivogen.com/family.php?ID=189&ID_cat=7&ID_sscat=93#groupe204
- Sigma B6650-10MG 5-Bromo-4-chloro-3-indolyl β-D-glucuronide cyclohexylammonium salt
- Sigma S2647-100MG Spectinomycin dihydrochloride pentahydrate
- Macherey-Nagel
- 740730.1 : NucleoSpin Robot-8 Plasmid http://www.mn-net.com/tabid/10885/default.aspx
- 740668 : NucleoSpin 8 Extract II
- 740682 : Starter Set A
- 740683 : Starter Set B
- 740680 : MN Frame
- Medium latex gloves
- autoclave deodorizers (VWR 11214-703)
- Three boxes of NEB 10-beta competent cells - # C3019I
- 4x each of following
- L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
- L1004 - LB Agar Plates with Ampicillin-100. 100 mm Plates, sterile. 20 Pack.
- L1017 - LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack.
- L1232 - LB Agar Plates with Chloramphenicol-34, Kanamycin-50. 100 mm Plates, sterile. 20 Pack.
- 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
- 200ul pipette tips
- 20ul pipette tips
- Qiagen spin miniprep kit 250
- Qiaex II gel purification kit
- 48-well egels
- 3x Drummond Portable Pipet-Aid rechargeable battery Drummond 4-000-035 VWR 53498-063
- 10uL pippette tips
- L5033 - LB Agar Plates with Tetracycline-15. 150 mm Plates, sterile. 20 Pack.
- L5025 - LB Agar Plates with Kanamycin-50. 150 mm Plates, sterile. 20 Pack.
- L5004 - LB Agar Plates with Ampicillin-100. 150 mm Plates, sterile. 20 Pack.
- L5017 - LB Agar Plates with Chloramphenicol-34. 150 mm Plates, sterile. 20 Pack.
- http://www.analytical-sales.com/
- Cat #: 24108 - 24 well square well plate - 1 case
- 6 sleeves LB-Tet plates from Teknova (VWR 100216-604)
- 1 box 14 mL culture tubes
- 48 well e-gels
- 250ul Multi-Channel Tips (Rainin SR-L250S)
- 5 boxes of NEB 10-beta competent cells - # C3019I
- Three boxes of NEB 10-beta competent cells - # C3019I
- NEB BstXI
- XbaI
- 20ul tips
- Tet plates from Teknova
- 2x boxes 12 well E-Gels
- Glass beads (VWR 26396-521)
- 2x NEB SpeI R0133S
- 2x NEB EcoRI-HF R3101S
- T4 DNA ligase (everyone seems to be out, order at least two aliquots?)
- 3x NEB 10-beta competent cells - # C3019I
- BioBrick assembly kit
- Teknova plates for distribution
- NUNC lids
- L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack - 4 of these
- reservoirs (VWR 82026-358)
- http://www.analytical-sales.com/
- minimum quantity of each of following
- Cat #: 47025 - 24 column, low profile plate
- Cat #: 96012 - 8 channel V-trough reservoir
- Cat #: 24108 - 24 well square well plate
- E-gels, .8% Agarose, 12 lane (down to last box, ~5 used already)
- 10ul multi-channel pipet tips, there was only one left in the box today and I couldn't see any other boxes.
- Nutrient Broth (Difco 234000)
- Fireboy cartridges (VWR 17919-890)
- 6x pairs of scissors (apparently someone eats them)
- ATCC 49762 Providencia stuartii
- 3 cases 50 ml serological pipets BD 357550 (VWR 53106-441)
- 3 cases 10 ml serological pipets BD 357551 (VWR 53300-523)
- 2x case 5 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul
- 384-well plates (for Distribution)
- LB Agar Lennox (VWR 90003-112)
- 2x case 200 Autoclave bags, clear, VWR 14220-042
- petri dishes (25384-250)
- 10 ul tips (53509-500)
- Bleach
- lab notebooks (VWR TX126643MT)
- EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
- NEB 10-beta competent cells - # C3019I (order two boxes)
- 2-log Ladder from New England Biolabs #N3200L
- NEB M.EcoRI M0211S
- NEB SbfI-HF R3642S
- adhesive foil covers (for Distribution)
- L1017 LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack - 8 of these (for postdocs)
- PstI large
- XbaI large
- SpeI large (postdocs 3/11/09)
- Invitrogen PCR Supermix Hi-Fi (postdocs, 3/11/09)
- Qiagen QiaQuick PCR purification kit 250 - cat no. 28106
- 96-well egels
- 48-well egels
- 20ul tips
- 200ul tips
- adhesive foil covers (VWR 60941-076)
- Bio Rad Order # IC0282947
- Biorad MLL-9601 - low profile unskirted natural pcr plates - ordered 1 pk
- Biorad MSP-9601 - microseal skirted natural - ordered 2 pks
- Millipore Millex-GV Filter unit 0.22 um pore size filters catalog no. SLGVR25LS (Req #11115919)
- Microflex latex gloves small and large
- 2 boxes of 12 well E-gels (Req #11121281)
- Cartridges for Ptouch labeller. 18mm, 3/4", Black ink on white, TZ-241 TZ tape
- GE templiphi 500 25-6400-50
- Teknova plates: (ReqID #11115915)
- Amp L1004
- Amp-Cm L1243
- Amp-Kan L1210
- Amp-Tet L1216
- Kan L1025
- Cm L1017
- NEB Order# 219818-OL
- NEB - EcoRIHF, XbaI, SpeI, PstI, T4 DNA ligase
- NEB lambda exonuclease M0262S
- NEB exonuclease III M0206S
- NEB 10-beta competent cells - # C3019I (order two boxes)
- Egels 12 well 0.8%
- NEB 10-beta competent cells - # C3019I
- 14 ml Polypropylene Round-Bottom Tube
- mobio.com 12300-50 6 minute mini plasmid prep kit
- ReqID 11110523:
- L1017 LB Agar Plates with Chloramphenicol-34. 100 mm Plates, sterile. 20 Pack - 6 of these
- L1004 - LB Agar Plates with Ampicillin-100. 100 mm Plates, sterile 20 Pack - 2 of these
- L1025 - LB Agar Plates with Kanamycin-50. 100 mm Plates, sterile. 20 Pack - 1 of these
- L5033 - LB Agar Plates with Tetracycline-15. 150 mm Plates, sterile. 20 Pack - 1 of these
- Phusion™ High-Fidelity PCR Master Mix with HF Buffer catalog # F-531S
- parafilm
- 48 well e-gels
- NEBbuffer 2 (unless we have a stash somewhere, we used 2 of 4 tubes in big -20)
- NEB T4 DNA ligase
- NEB 10-beta competent cells - # C3019I
- Acinetobacter baylyi ATCC 33305
- 2 cases petri dishes
- ReqID 11106769
- Fireboy gas canisters (VWR 17919-890)
- adhesive foil covers (VWR 60941-076)
- LB broth
- NEB streptavidin magnetic beads S1420S
- ReqID: 11105446
- Invitrogen PCR Supermix High Fidelity (Invitrogen 10790-020)
- 100 cylindrical 0.125x0.125 magnets
- 100 cube 0.125 x 0.125 magnets
- 50 cube 0.187x0.187 magnets
- ReqID: 11104249
- case N-DEX gloves, large
- case N-DEX gloves, medium
- cases of 10,20,200,and 1000 pippette tips (no full cases of any left, though there are a few boxes of the 1000s)
- Invitrogen PCR SuperMix
- Invitrogen ChargeSwitch CS10201 (for assembly)
- Roche Protease Inhibitor, Complete Mini, EDTA-Free, 11836170001
- Sigma D-7384-100G, Decanal
- NEB EcoRI-HF R3101S
- 2x boxes Invitrogen 12-well 0.8% E-Gels
- Req ID: 11084279
- 2 case petri dishes
- GL45 media bottle caps, membrane, blue, Kimax 14395M45, VWR 89000-948, box 10
- Qiagen miniprep kit --Meaganl 11:45, 21 November 2008 (EST)
- NEB EcoRI R101S --Meaganl 11:45, 21 November 2008 (EST)
- NEB T4 DNA ligase M0202S --Meaganl 11:45, 21 November 2008 (EST)
- 3x Invitrogen NuPage sample reducing agent (10x) 250 ul, cat NP0004
- L-Arabinose- A3256-100G Sigma
- 3x Difco LB Agar, Lennox, 500g
- 2x gal bleach
- Difco Agar Noble 500g Ref 214230 (ON BACKORDER)
- MRS broth, BD 288130, 500g VWR 90004-082 (Temporarily on backorder)
- Case Microcentrifuge Tube Boxes, 1.5 ml, Nalge/Nunc 5055-5015, VWR 55710-175
- NUNC 5-spot grey holder boxes VWR #534479
- 20x Gibco yeast extract Cat. # 18180-059
- Sigma C5080-500g Calcium chloride dihydrate, Sigma-Ultra
- large latex gloves evolution one Reorder #: EV-2050-L
- Case Kimwipes, EX-L
- Sterile reagent reservoirs 100ml case 100 VWR 82026-358
- 3x pack 300 disposable spatula, standard, opaque, VWR 80081-190
- Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
- Sigma M1633-1G 4-Methylumbelliferyl beta-D-galactopyranoside
- 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
- 2x EMD OmniPur Sucrose 500g
- 3mm glass balls (for spreading transformed cells on plates)- no more left
- Difco Heart Infusion Broth Ref. # 238400, 500 g
- 1 case 10 Axygen MCT-200-C-S microtubes
- 1 case 10 Axygen MCT-175-C-S microtubes
(Req ID: 11027695)
- 2x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011)
- nalgene cryoware cryogenic vials Cat #5000-0020 (last case, 2 bags left-order Thurs. July 10th if possible)
- case BD 305491 5 gal sharps containers (VWR BD305491)
- 2x pack 50 VWR electroporation cuvettes, 1 mm, VWR 89047-206
- 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
- 14 mL culture tubes
- case 1000 BD 352054 5ml culture tubes (VWR 60819-310)
- case 72 VWR Traceclean 20 ml vials with fluoropolymer resin/silicone septum VWR 15900-008
- case 72 Nalgene boston round bottles, 8 ml, polypropylene, NNI 2006-9025, VWR 16066-981
- 2 cases 200 ul pipet tips, barrier, sterile, racked VWR 14217-728
- NEB M0201S T4 polynucleotide kinase
- 2 x TOP10 one-shot chemically competent cells SKU# C4040-03
- Egel 12 lane gels .8 or 1%, only 5 or 6 are left
- Qiagen RNeasy Protect Bacteria Mini Kit Cat. #74524
- 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
- Qiagen RNase-Free DNase Set Cat. #79254
- ReqID: 11013874 (for PO)
- 10x Rainin 250ul multichannel tips (SR-L250S)
- 10x 1200ul multichannel tips
- 2x DpnI from NEB (amount in -20 freezer restriction enzyme box is gone) Note: You can get the following free from NEB
- Receive a free Protein Ladder Sample with any purchase.
- 2x NEB Phusion Flash high fidelity master mix F-548L (large version)
- EMD OmniPur Sucrose 500g
- 3M Micropore breathable cover for 96-well plates
- 4x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011)
- 2x Invitrogen S.O.C. medium 10x 1 ml, #15544-034
- Costar 3370 (96 well flat bottom assay plate)
- 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076
- 2x Rainin 250ul multichannel tips (SR-L250S)
- 2x 1200ul multichannel tips
- NEB BfuCI R0636S
- Sigma beta-galactosidase G4155-1KU
- large latex gloves evolution one Reorder #: EV-2050-L
- greiner 96-well plates catalog #T-3026-16
- 3x VWR aluminum foil plate seals, sterile, pack 50, VWR 60941-076 (ReqID: 11000465)
- Invitrogen PCR SuperMix (only 2 tubes left) (ReqID: 11000464)
- Rainin 250ul multichannel tips (SR-L250S)
- 1200ul multichannel tips
- ReqID: 10996069
- Case 50, Greiner 2 ml clear Masterblock deep well plates, sterile, Greiner 780271, VWR 82051-248
- 2x case 50, Nunc Microwell 96-well polystyrene plates, sterile, 0.3 ml, V-bottom, Nunc 249662, VWR 62409-112 (ON BACKORDER - SHIPPING 5/12)
- 2x case 50, Nunc Microwell plate lids, sterile, cut off corners, Nunc 264122, VWR 62409-118 (ON BACKORDER - SHIPPING 5/6)
- 2x case 500, Axygen self-standing conical screw cap tubes, sterile, assorted colors, Axygen SCT-050-SS-A-S, VWR 10011-502 (ON BACKORDER - SHIPPING 5/22)
- 2x NEB Sau3AI R0169S (ON BACKORDER INDEFINITELY - DO YOU WANT TO CANCEL?)
- Sciencelab 60-136380518 polyethylene fritware sheet, 70 micron, 18"x18" 1/8" thick
- ReqID: 10913140
- Daigger FX23461AX 96 well PCR racks, assorted colors, 4x pack 5 (on backorder --Meaganl 11:46, 27 August 2007 (EDT))
- Get these Greiner plates instead: Endy:Victor3_plate_reader/Plates (catalog # T-3026-16) (reqID: 10996115)
- 20x Invitrogen/Gibco yeast extract 18180-059 (ReqID# 10996112)
- 6x Zymo Genomic DNA prep plates 4x 96 well plate kit (D3011) (Order # 107945)
- 2x NEB Buffer 2 pack, B7002
- Rainin 10ul multichannel tips (SR-L10S)
- ReqID: 10996069
- 3x Sterile reagent reservoirs 100ml case 100 VWR 82026-358
- 3x Petri-stickers, Diversified Biotech PSTK-1050, [1]
- 3x cases 200 ul pipet tips
- 2x cases 20 ul pipet tips
- 2x pack 50 VWR electroporation cuvettes, 1 mm, 89047-206
- Difco Heart Infusion Broth, 238400, 500g
- Difco/BD 220215 sterile disposable inoculating loop, 1 ul, 50/tube, pack 1000, VWR 90001-098
- ReqID:
- 6x Sigma H1138 horse serum, donor herd, heat inactivated, 500 ml
- Sigma I1284 IPTG
- NEB protein ladder, P7703S
- Rainin 250ul multichannel tips
- 2x NEB DpnI R0176S
- aluminum foil
- 2x gal Pharmco ethanol, 190 proof
- 2x gal Pharmco ethanol, 200 proof
- 10x Invitrogen/Gibco Yeast extract solution, 100 ml, cat. 18180-059
- pack 50 VWR electroporation cuvettes, 1 mm gap VWR 47727-640
- pack 50 VWR electroporation cuvettes, 2 mm gap VWR 47727-642
- 3x cases petri dishes
- Axygen screw top microtubes, amber, 0.5 ml, self standing, ST-050-SS-X, VWR 10011-656, pack 500
- 2x case 10 ml pipets
- 2x case 25 ml pipets
- 2x case 50 ml pipets
- Pfu turbo DNA polymerase catalog no 600250 from Stratagene
- Qiagen ERC MinElute cleanup kit large #28206
- 20x Brother TZ-241 3/4" black on white label tape
- Sigma M1633-250MG 4-Methylumbelliferyl beta-D-galactopyranoside
- NEB PvuII R0151S
- Sigma 43816-50ML, DTT, 1 M solution, 50 ML
- Sigma D0632-10G, DTT, 10g
- Invitrogen NuPage MOPS SDS running buffer, 20X, 500 ml, cat NP0001
- Invitrogen NuPage LDS sample loading buffer (4x) 10 ml, cat NP0007
- Invitrogen NuPage sample reducing agent (10x) 250 ul, cat NP0004
- NEB Chitin beads S6651L (large version)
- pack 50 VWR Signature electroporation cuvettes, 2mm gap, VWR 89047-208
- sterile inoculating loops
- NEB B0202S T4 DNA Ligase buffer pack (4x 1.5 ml buffer)
- 2x Invitrogen NuPage 10% Bis-Tris Gels, 1.0mm x 9 well, cat NP0307BOX
- ReqID: 10970539 (6)
- 2x Difco SOB medium 244310, 500g (On backorder)
- 4x gal bleach
- Fermentas PpiI, cat #: ER1541, 50 units, $66
- SibEnzyme MabI, cat #: E121, 200 units, $40
- SibEnzyme PsrI, cat #: E131, 100 units, $50
(-Julie)
- ReqID: 10975136
- Molec bio grade ethanol (Sigma 7023-500ml)
- ReqID: 10975027
- (3) NUNC Universal lids, sterile (VWR 73520-150, Nunc 250002)
- ReqID: 10974958
- Qiaprep Spin Miniprep Kit (250), Cat. #27106
- Reagent reservoirs
- (5) Teknova Amp plates
- ReqID: 10974975
- GE(Amersham) templiphi 100
- Epicentre EZ-Tn5 transposase
- 2x case 12 Nalgene SFCA bottle top filters, 500 ml, VWR 291-4520
- 10ul tips (VWR 53509-500)
- NEB EcoRI
- NEB XbaI
- NEB T4 PNK M0201S
- ReqID: 10968275
- Sterile inoculating loops (VWR 12000-810)
- Teknova AMP plates (VWR 100216-550)
- Media cart for holodeck
- ReqID: 10967075
- Glycerol
- Sigma C5080 Calcium Chloride dihydrate, 500g
- ReqID: 10967081
- Microgrip Nitrile Gloves (40101-346)
- half-height round bottom 96-well plates - 3cs (82051-244)
- ReqID: 10963590
- Pierce 31503 Superfreeze peroxidase conjugate stabilizer, 25 ml
- Costar 3960 (96 deep well culture plates)
- 1 case 10 Axygen MCT-200-C-S microtubes
- ReqID: 10963547
- 0.8% 12 well e-gels from Invitrogen (G5018-08)
- Invitrogen 10x TAE
- ReqID: 10963590
- 3x case 200 ul pipet tips (VWR 14217-728)
- Falcon 14ml tubes 352059 (VWR 60819-761)
- freezer boxes (w foam inserts) (Nalgene 5055-5015)
- ReqID: 10963609
- PBS (pH 7.4) 1L
- EZ-Tn5 transposase
- 1 case 10 Axygen MCT-060-C-S microtubes
- 1 case 10 Axygen MCT-175-C-S microtubes
- 3x case Nalgene Cryoware Cryo Vials, Cat # 5000-0020
- 2x case 10 ml disposable pipets
- 2x case 50 ml disposable pipets
- ReqID: 10956768
- Reagent reservoirs, VWR 82026-358
- Teknova Amp plates (L1004)
- 4 bottles LB agar (240110)
- Spiral bound computation books (lab notebooks). Ampad #22-157. VWR TX126643MT
- Autoclave bags, 25" x 35", VWR 14220-042
- Petri dishes, two cases (25384-250)
- ReqID: 10954559
- Invitrogen PCR Supermix
- 10 ul tips
- --Meaganl 13:43, 9 January 2008 (CST)
- Req ID: 10949471
- 2x Sucrose, EMD Omnipure, 500 g
- 20x Brother TZ-241 3/4" black on white label tape
- Req ID: 10949254
- Difco 0142 Agar Noble, 500g
- 2 dozen Campingaz / Coleman CV360 butane canisters (for Fireboy) VWR 17919-890
- 1000ul tips
- Pierce EZ-link Psoralen-PEO-biotin, 5 mg #29986
- Pierce Streptavidin Horseradish peroxidase conjugated, 1 mg, # 21126 (in -20)
- Pierce Immunopure biotinylated horseradish peroxidase, 5 mg, # 29139
- Pierce One-step Ultra TMB-substrate, 250 ml # 34028
- Pierce Ultralink immobilized streptavidin, 2 ml, # 53113
- Req ID: 10949274
- Sigma M0262 Methylcellulose viscosity 400 cP, 2 % in H2O, 100g
- Sigma E5529 EZ-view red streptavidin affinity gel, 1 ml
- case BD sharps collector 3.1 liter BD 305488
- Qiagen ERC MinElute cleanup kit large #28206
- Req ID: 10949471
- Req ID: 10937895
- Nitric acid, concentrated, 1 liter
- NEB BsmBI R0580S
- ReqID: 10946402
- Invitrogen Sybr Safe
- ReqID: 10946457
- Sigma Aldrich 151238 Glycidyl methacrylate 5 grams
- Sigma B9300 Benzophenone 500 grams
- Sigma Aldrich 311448 Sodium periodate 5 grams
- Sigma S4762 Streptavidin 1 milligram
- Sigma T4174 10×, 5.0 g porcine trypsin and 2 g EDTA • 4Na per liter of 0.9% sodium chloride 100 ml
- Sigma T4799 Trypsin from procine pancreas 5 grams
- Sigma T9003 Type I-S Trypsin inhibitor, lyophilized powder (Sigma), 100 milligrams
- 200ul tips
- ReqID: 10943944
- 5x horse serum, Sigma
- 10x Invitrogen/Gibco Yeast extract solution, 100 ml, cat. 18180-059
- ReqID: 10943885
- Qiaprep Spin Miniprep Kit (250), Cat. #27106
- 8 strip ultra clear caps Cat No TCS-0803 clear from MJ Research (now BioRad - same cat. number)
- Low tube strip, CLR from BioRad catalog no. TLS0801 (please buy equal numbers as caps
- Rainin SR-L250S multichannel tips (250 uL capacity)
- Harris Uni-Core punches, 0.35, 0.50, 0.75, 1.0 mm, four each, Ted Pella
- Hydrochloric acid, concentrated, 1 liter
- EZ-Tn5 transposase, Epicentre, EZ-Tn5
- Req ID: 10937925
- 6x Horse Serum, Donor Herd, Sigma H1138, 500 ml
- 200μL multichannel tips from Rainin
- Acetic acid, glacial, 1 liter
- ReqID: 10936396
- 2x case 5 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul
- large latex gloves evolution one Reorder #: EV-2050-L
- Difco LB Agar, Lennox, 500g
- 1 box Invitrogen PCR Supermix High Fidelity cat. 10790-020
- multichannel 10ul tips Rainin SR-L10F
- Ptouch label supplies 3/4in white background, black ink - TZ-241
- Zymo ZR96 genomic DNA kit, 4 x 96 well plates D3011, Zymo site
- Amylose resin from NEB (Catalog no. E8021S) --Reshma 14:38, 25 November 2007 (CST)
- NEB PstI
- P1000 tips
- Qiaprep Spin Miniprep Kit (250), Cat. #27106 (only 10 or so columns left may want to order before Thurs)
- Qiagen Qiaex II Gel Extraction Kit, Cat. #20051
- NEB MboI (large) R0147L
- 1 NEB T4 DNA Ligase M0202S (need before Thursday)
- Invitrogen Sybr Safe
- ReqID: 10930951
- Case Microcentrifuge Tube Boxes, 1.5 ml, Nalge/Nunc 5055-5015, VWR 55710-175
- 2x case 12 Nalgene 291-4520 SFCA Bottle Top Filter 75mm dia filter, 45 mm cap, VWR 28199-307
- 3x Novagen Pellet Paint NF #70748 (available through VWR)
- 2x case Nalgene cryo vials Nalgene 5000-0020
- Sau3AI, NEB R0169S
- PvuII, NEB R0151S
- Phusion HF master mix, NEB F531S
- pack 50 VWR Signature electroporation cuvettes, 2mm gap, VWR 89047-208
- ReqID: 10923808
- EZ-Tn5 transposase, Epicentre, EZ-Tn5
- Req ID: 10920911
- VWR 12x75mm polypropylene round bottom sterile tubes Cat No 60818-576
- BD Falcon 352054 5ml polystyrene falcon tube
- 2x cases 50 ml plug seal centrifuge tubes, sterile, racked (VWR 20171-028 --Meaganl 12:31, 17 October 2007 (CDT))
- 2x cases 15 ml plug seal centrifuge tubes, sterile, racked (VWR 20171-024 --Meaganl 12:31, 17 October 2007 (CDT))
- 2x 1/4 oz. Immersion oil type DF low fluorescence, CARGILLE LABORATORIES, VWR 48218-506
- VWR 33725-042 Glas-Col Mini-rotator (099A-MR1512) 120v (another one, now that we know they work well)
- 2x boxes 12 well 0.8% agarose E-Gels
- exo I M0293S
- DpnI R0176S
- ReqID: 10915844
- Sodium deoxycholate from Sigma 30970-25G
- MboI NEB R0147S
- 2x cases Petri dishes
- Pack 768 VWR 87006-060 Barrier tips, sterile, extended length, 1000 ul (on backorder)
- Daigger FX4727A 250 ml polypropylene centrifuge tubes, 250 ml, Pack 12 (on backorder --Meaganl 11:46, 27 August 2007 (EDT))
- VWR 33725-042 Glas-Col Mini-rotator (099A-MR1512) 120v (On backorder until 9/24) --Meaganl 14:45, 20 September 2007 (EDT)
- ReqID: 10906942
- Falcon 14ml tubes 352059 (3 boxes, we go through them fast)
- 3x Drummond Portable Pipet-Aid rechargeable battery Drummond 4-000-035 VWR 53498-063
- case 12, Nalgene MF75 Bottle top vacuum filters, Surfactant free CA, 500 ml, 0.20 micron, NNI 291-4520, VWR 28199-307
- ART 10ul tips
- Pack 768 VWR 87006-058 Barrier tips, sterile, 250 ul
- 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
- 6x Invitrogen/Gibco Yeast extract, 100 ml, cat. 18180-059
- ReqID: 10904172
- Roche Dig-High Prime DNA labeling and detection starter kit II for chemiluminescent detection cat 11 585 614 910
- Roche Digoxigenin-11-dUTP, alkaline labile 25 nmol, cat 11 573 152 910
- ReqID: 10904145
- BD 35 2059 polypropylene round bottom tubes, 14 ml, 17 x 100 mm
- ReqID: 10904171
- Sigma 77617 Fluka Biochimika ultra Phenol Chloroform Isoamyl alcohol mixture 25:24:1, 100 ml
- ReqID:10898629
- Pierce B-PER bacterial protein extraction reagent 500 ml #78248
- Req ID: 10901718
- K3007 N-(β-Ketocaproyl)-L-homoserine lactone from Sigma
- Invitrogen UltraPure Agarose 15510-027
- Invitrogen Sybr Safe
- ReqID: 10901688
- 3x pack 1000 MCT-060-C-S
- 1x case 10 MCT-175-C-S
- 1x case 10 MCT-200-C-S
- 2x pack 100 Axygen Cyclerseal PCR-TS, VWR 10011-120
- case 36 BD 353226 24 well plates, 6/bag, VWR 62406-159
- NEB P8101S Modified Trypsin
- NEB S6651S Chitin beads
- NEB M0280S UDG
- Roche Complete mini EDTA free protease inhibitor cocktail, glass vial 25 tablets, 11 836 170001 --Meaganl 10:12, 4 September 2007 (EDT)
- 3x Crane's Thesis Paper100% Cotton, Acid Free, 500 sheets (SKU BT886S)
- Daigger FX28271J 6x10 4 mil polyethylene bags, case 1000
- recombinant EGFP 100ug (Order # 120924)
- Nalgene Cryoware Cryo Vials, Cat # 5000-0020 --Meaganl 10:50, 22 August 2007 (EDT)
- 2x VWR 55411-050 single edge razor blades, pack 100 --Meaganl 10:50, 22 August 2007 (EDT)
- Qiagen miniprep kit
- Sap1 restriction enzyme
- 95% ethanol
- 100x Olfa Green Mat, 6" x 8
- 6x Invitrogen 18180-059 Yeast extract solution --Meaganl 14:05, 14 August 2007 (EDT)
- 2x Invitrogen E-Gel .8% Agarose, Cat #G5018-08 --Meaganl 14:05, 14 August 2007 (EDT)
- Pfu turbo DNA polymerase catalog no 600250 (100 U) from Stratagene.--Meaganl 14:05, 14 August 2007 (EDT)
- 100x Harris Uni-core punch, disposible, 2mm
- Req ID: 10893241
- 2x pack 50 VWR Signature electroporation cuvettes, 1mm gap, VWR 47727-640 --Meaganl 11:49, 14 August 2007 (EDT)
- Topoisomerase 1 from E. coli 100 units catalog # M0301S
- Epicentre EZ-Tn5 transposase TNP92110, 10 units
- Req ID: 10890897
- 3x cases 20 ul tips
- 3x cases 200 ul tips
- 3x cases 1000 ul tips
- Invitrogen Sybr Safe
- Harris Uni-core punch, disposible, 2mm
- C. S. Osborne Belt punches, sizes 00, 0, 1, 2
- Olfa Green Mat, 6" x 8"
- Ptouch 3/4" white black ink labelling supplies TZ-241 (10x)
- Qiagen Minelute PCR Cleanup Kit (250) # 28006
- 2-log Ladder (from New England Biolabs) #N3200L
- Invitrogen E-gel-48
- NuPAGE® Novex 4-12% Bis-Tris Gel 1.0 mm, 12 well NP0322BOX - 1 box
- Req ID 10887733
- Spiral bound computation books (lab notebooks). Ampad #22-157. VWR TX126643MT
- 100ml reservoirs VWR 82026-358
- Falcon 14ml tubes 352059
- Nalgene blue 16mm test tube racks (for holding 14ml tubes)- 60914-730
- Req ID: 10886117
- Difco LB Agar Lennox Ref. 240110
- Foil adhesive covers (60941-074)
- 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
- ReqID: 10883548
- 2x cases petri dishes
- 2x cases 12 Nalgene 290-4520 SFCA bottle top filter, 150ml, 45mm neck, 50 mm membrane, 0.2u filter
- 2x PstI R0140S
- Robot: SpeI
- ReqID: 10878908
- Bleach
- multichannel 10ul tips Rainin SR-L10F
- VF2 and VR Primers
- Robot: 30ml and 100ml reservoirs
- Alconox Alcojet dishwashing detergent (let me know if you need a catalog no.)
- ReqID: 10874005
- Sigma C7901-25G Chelex 100
- SeeBlue® Plus2 Pre-Stained Standard - Invitrogen Catalog Number - LC5925
- Robot: Invitrogen E-gel 48
- MicroAmp™ Optical 96-Well Reaction Plate (Part# N8010560) - 10 Plate Package
- 2x E-Gel 0.8% agarose (GP) #G5018-08
- ReqID: 10871228
- TempliPhi 100 Amplification Kit
- NEB phi29 DNA polymerase M0269S
- Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
- T4 endo VII http://www.mclab.com/product.php?productid=18100&cat=292&page=1
- TDG H00006996-Q01 http://www.novusbio.com/data_sheet/index/H00006996-Q01
- NEB BbsI R0539S
- Robot: Sigma ATP (3x)
- 1 500 mL bottle of Ethyl acetate catalog # MK499204 at VWR
- BD Falcon 352063 (VWR 60819-728)
- 14 mL culture tubes Falcon 352059 (VWR 60819-761)
- DNA Topoisomerase I, Vaccinia (500 U)
- Propidium iodide Invitrogen P1304MP
- NuPAGE® Sample Reducing Agent (10X) NP0004
- NuPAGE® Novex 4-12% Bis-Tris Gel 1.0 mm, 12 well NP0322BOX
- Immobilized Streptavidin Pierce #20349 (VWR # PI20349)
- 100 ml multi-well pipettor reservoirs
- Spherotech ACFP-100-3 AccuCount Fluorescent Particles 8.0-12.9 µm, 3 mL
- 3x Novagen Pellet Paint NF #70748 (available through VWR)
- Qiagen miniprep spin kit (250) # 27106
- Qiagen Minelute PCR Cleanup Kit (250) # 28006
- NEB M0302S endo I
- NEB M0305S endo V
- (2cs) Petri dishes
- Sigma M2128 Thiazolyl Blue Tetrazolium 500 mg
- K3007 N-(β-Ketocaproyl)-L-homoserine lactone from Sigma
- polypropylene tubes VWR catalog# 60818-576
- Spherotech RCP-60-5 calibration beads
- 8 well strip tubes, clear, low profile
- 1 case of 10ul tips (not via requisition; on CC)
- Req ID: 10855012 Ampicillin salt (Sigma A9518)
- Req ID: 10854533 TempliPhi 100 (Amersham/GE Healthcare)
- 3 boxes Invitrogen PCR Supermix High Fidelity cat. 10790-020
- Req ID: 10854540
- two dozen black ultra-fine point Sharpies
- Req ID: 10854530
- case BD 305491 5 gallon sharps containers
- case Nalgene 5055-5015 microcentrifuge box, 64 places, foam insert
- 2 cs 10ul tips
- 6 cs 20ul tips
- 3 cs 200ul tips
- 3 cs 1000ul tips
- scotch tape. The rolls that can be put in existing dispensers.
- large latex gloves
- Mermaid kit, 200 preps, [2]
- Geneclean III kit, 600 preps, [3]
- (3) NEB T4 DNA Ligase M0202S
- NEB phi29 DNA polymerase M0269S
- ReqID 10851873
- Sigma D157805-5G N,N'-dimethylethylenediamine
- Invitrogen Sybr Safe
- PO# 10847064
- Nonidet-P40 substitute Sigma 74385-1L
- Tween-20 Sigma P7949-100ML
- Tween-40 Sigma P1504-100ML
- Tween-80 Sigma P8074-100ML
- Glycerol (Sigma G6279) -- on backorder
- 1.7mL clear sterile tubes (Reshma) --Meaganl 09:43, 12 April 2007 (EDT)
- Reshma 09:41, 19 March 2007 (EDT): Cartridges for Ptouch labeller. 18mm, 3/4", Black ink on white, TZ-241 TZ tape
- Trevigen TDG 4070-500-EB
- Trevigen MutY 4000-500-K
- Beckman Futura pH electrode, 511083 Calomel, 5mm x 225 mm VWR BK511083
- Beckman reference solution 4M KCl, 4 x 100 ml, 566468 VWR BK566068
- --Meaganl 14:44, 3 April 2007 (EDT)
- Reshma 11:55, 23 March 2007 (EDT): SpeI
- NEB EarI (yes again) R0528S
- NEB endo IV M0304S
- NEB endo VIII M0299S
- Qiagen miniprep kit (large)--Meaganl 10:32, 3 April 2007 (EDT)
- Immobilized Streptavidin Pierce #20349 (VWR # PI20349) --Meaganl 13:42, 26 March 2007 (EDT)
- Reshma 11:23, 19 March 2007 (EDT): Nalgene cryovials
- Reshma 17:06, 8 March 2007 (EST): 14 mL culture tubes Falcon 352059
- Reshma 13:44, 8 March 2007 (EST): Difco LB Lennox Broth
- NEB BsmBI R0580S --Meaganl 10:41, 22 March 2007 (EDT)
- Ambion superase-in #2694 --Meaganl 15:16, 15 March 2007 (EDT)
- Reshma: Qiagen ERC MinElute cleanup kit large #28206
- Reshma: PCR supermix
- --Meaganl 11:05, 9 March 2007 (EST)
- case BD sharps collector 3.1 liter 305488
- case standard petri dishes 100 x 15 mm VWR # 25384-250
- 3x bottles bleach
- 4 cases 1000 ul barrier pipet tips VWR 14217-730
- 4 cases 200 ul barrier pipet tips VWR 14217-728
- 3 cases 50 ml serological pipets BD 357550
- 3 cases 10 ml serological pipets BD 357551
- 1 case 25 ml serological pipets BD 357525
- NEB phi29 DNA polymerase M0269S --Meaganl 16:29, 8 March 2007 (EST)
- NEB BbsI R0539S --Meaganl 16:29, 8 March 2007 (EST)
- NEB EarI R0528S --Meaganl 16:29, 8 March 2007 (EST)
- Invitrogen Sybr Safe --Meaganl 16:27, 6 March 2007 (EST)
- NEB T4 DNA ligase large (M0202L) PO# 0010830023 --Meaganl 08:49, 2 March 2007 (EST)
- VWR 3 1/2 mm glass beads 1lb pack 26396-521 (PO# 10826298) tk 15:32, 26 February 2007 (EST)
- Invitrogen E-Gels, 0.8% EtBr, Single comb, pack 18, G5018-08 tk 15:32, 26 February 2007 (EST)
- PO #10825054
- PO# 10823861
- GE Healthcare Sephacryl S-500 HR 150 ml, Cat 17-0613-01 VWR 95016-920 tk 15:32, 26 February 2007 (EST)
- GE Healthcare Sephacryl S-400 HR 150 ml, Cat 17-0609-01 VWR 95016-912 tk 15:32, 26 February 2007 (EST)
- GE Healthcare Sephacryl S-300 HR 150 ml, Cat 17-0599-01 VWR 95016-908 tk 15:32, 26 February 2007 (EST)
- Polybead polystyrene red dyed microspheres, 0.2 micron, 2.5% aqueous solution, smallest amount tk 15:32, 26 February 2007 (EST)
- Order # 47T9282PPGGQ8LDHCRF9WDNN82
- PO#10822102
- Sucrose, Omnipure, EMD, VWR #EM-8510, 500g
- PO#10822065
- 3x pack 300 disposable spatula, standard, opaque, VWR 80081-190
- NEB BsmBI
- 2x NEB 2-log ladder, large N3200L
- P-10 tips (2 cases) --Meaganl 09:44, 2 February 2007 (EST)
- Multichannel 1200ul pipette tips --Meaganl 09:44, 2 February 2007 (EST)
- Bio-rad PCR strip tubes #TLS0801 (5 boxes) tk 19:13, 31 January 2007 (EST)
- NEB β Agarase I M0392S --Meaganl 14:37, 31 January 2007 (EST)
- Epicentre CircLigase #CL4111K --Meaganl 13:36, 30 January 2007 (EST)
- Micropure EZ columns Catalogue Number: 42530 from Millipore (shipped on 1/26)--Meaganl 13:36, 30 January 2007 (EST)
- Shipped on 1.26 --Meaganl 14:22, 29 January 2007 (EST)
- Qiagen RNase-free Dnase set Cat #79254
- Qiagen RNeasy minelute cleanup Cat #74204
- Qiagen ERC MinElute cleanup kit #28204
- EDTA disodium salt for molecular biology 500g Sigma E5134 --Meaganl 09:48, 24 January 2007 (EST)
- Sigma S7547-1Kg D-Sorbitol Sigmaultra --Meaganl 09:48, 24 January 2007 (EST)
- Sigma M6880-25G (malachite green oxalate salt) --Meaganl 09:48, 24 January 2007 (EST)
- DEPC - 25mL (Sigma) --Meaganl 09:48, 24 January 2007 (EST)
- 2x packs 100, BD Syringe 3 ml Luer Lok, BD 309585 --Meaganl 09:48, 24 January 2007 (EST)
- NEB N0345S Yeast Chromosome PFG Marker --Meaganl 21:36, 23 January 2007 (EST)
- NEB N0340S Lambda ladder PFG Marker --Meaganl 21:36, 23 January 2007 (EST)
- PMSF 100 mM in ethanol 50 ml Biochemika 93482 --Meaganl 14:56, 22 January 2007 (EST)
- N-lauroyl sarcosine sodium salt 30% solution 100 ml Biochemika 61747 --Meaganl 14:56, 22 January 2007 (EST)
- 2 cases standard petri dishes 100 x 15 mm VWR # 25384-250 --Meaganl 14:56, 22 January 2007 (EST)
- 4L cubetainer of 10x TBE buffer VWR EM-8820 --Meaganl 14:56, 22 January 2007 (EST)
- ClaI NEB R0197S --Meaganl 14:56, 22 January 2007 (EST)
- P-10 tips --Meaganl 14:56, 22 January 2007 (EST)
- 2 4L cubetainers of 10X TAE buffer Invitrogen #15558-026 --Meaganl 11:48, 18 January 2007 (EST)
- SYBR gold (Invitrogen catalog number S-11494) --Meaganl 11:48, 18 January 2007 (EST)
- Invitrogen Sybr Safe --Meaganl 11:48, 18 January 2007 (EST)
- Nunc Deepwell 384-well plates
- EcoR1, small (Robot)
- SpeI, large (Robot) x2
- PstI, small (Robot)
- Eppendorf Robot Miniprep kits x2 --Reshma 15:17, 10 January 2007 (EST)
- XbaI --Reshma 15:17, 10 January 2007 (EST)
- Difco LB Agar, Lennox--Meaganl 10:39, 9 January 2007 (EST)
- illustra TempliPhi 100 Amplification Kit (Amersham/GE Healthcare) tk 22:01, 22 December 2006 (EST)
- 200 ul pipet tips (3 cases)--Meaganl 07:46, 21 December 2006 (EST)
- 20 ul pipet tips (2 cases)--Meaganl 07:46, 21 December 2006 (EST)
- 1000 ul pipet tips (3 cases)--Meaganl 07:46, 21 December 2006 (EST)
- Falcon 14ml tubes 352059--Meaganl 07:46, 21 December 2006 (EST)
- AG 501-X8(D) Resin, molecular biology grade, 100 g, catalog number 143-6425 from Bio-Rad--Meaganl 07:46, 21 December 2006 (EST)
- Sigma Molecular Bio Grade 200 proof ethanol--Meaganl 10:12, 20 December 2006 (EST)
- RNaseZap wipes (Ambion AM9786)--Meaganl 10:12, 20 December 2006 (EST)
- Alpha Innotech (replacement) EtBr filter EBR-500K
- Qiagen miniprep kit (2 of these I believe) --Reshma 13:52, 9 December 2006 (EST)
- Eppendorf 30ml robot reagent reservoirs --Meaganl 14:22, 3 December 2006 (EST)
- 100ml sterile reagent reservoirs--Meaganl 11:26, 1 December 2006 (EST)
- (VWR) Nalgene microcentrifuge tube boxes (case)--Meaganl 11:26, 1 December 2006 (EST)
- Plastic disposible cuvettes, OPS, 10x10x45 mm, 2 optical surfaces, VWR 58017-825, case 500--Meaganl 11:26, 1 December 2006 (EST)
- Plastic disposible cuvettes, OPS, 10x4x45 mm, 2 optical surfaces, VWR 58017-847, case 500--Meaganl 11:26, 1 December 2006 (EST)
- Difco Bacto Agar 0140-01--Meaganl 11:26, 1 December 2006 (EST)
- Sigma L5263-25KU, Lyticase from Arthrobacter luteus, partially purified--Meaganl 15:33, 30 November 2006 (EST)
- Sigma 73660-5G Biochemika 99%+ 2-nitrophenyl β-D-galactopyranoside (ONPG)--Meaganl 15:44, 29 November 2006 (EST)
- SpeI NEB R0133S--Meaganl 15:04, 28 November 2006 (EST)
- NotI NEB R0189S--Meaganl 15:04, 28 November 2006 (EST)
- β-Agarase I NEB M0392S--Meaganl 15:04, 28 November 2006 (EST)
- Sigma 43816-50ml DL Dithiothreitol solution 1M Biochemika ultra -- tk 14:18, 27 November 2006 (EST)
- Sigma S7547-1Kg D-Sorbitol Sigmaultra --Meaganl 11:30, 27 November 2006 (EST)
- Sigma D5545-1G DL Dithiothreitol Sigmaultra --Meaganl 11:30, 27 November 2006 (EST)
- Brother Labeler 18mm 3/4" black ink on white tape --Meaganl 10:06, 27 November 2006 (EST)
- Nalgene microcentrifuge tube boxes (only got 4 boxes) --Meaganl 11:22, 20 November 2006 (EST)
- BD 60ml syringes --Meaganl 11:22, 20 November 2006 (EST)