User:Anthony Salvagno/Notebook/Research/2010/12/17/Custom Plasmid for Unzipping/Stretching Construct: Difference between revisions
| Line 5: | Line 5: | ||
:'''5' - CCAACGATCTGG''' | :'''5' - CCAACGATCTGG''' | ||
which produces the overhang '''CGAT''', which is complementary to our adapter duplex. I'm allowed for anything up to 300bp (because it is the same price) so I'm pondering if I should add more too it or not. Right now I'm going with no and am requesting a quote. If I did add more what would it be? | which produces the overhang '''CGAT''', which is complementary to our adapter duplex. I'm allowed for anything up to 300bp (because it is the same price) so I'm pondering if I should add more too it or not. Right now I'm going with no and am requesting a quote. If I did add more what would it be? | ||
For shits and giggles I'm going to add a SapI recognition site in before the BstXI site, This sequence would be: | |||
:'''5' - GCTCTTCCAGCTC''' | |||
Because of the nature SapI it will leave a 5' overhang of AGC (cutting right after the CC above) which can be ligated onto the adapter duplex for unzipping. | |||
Koch also wants me to add the high-affinity nucleosome binding site. I'm not sure this is what I need but: | |||
:'''5' - ctggagata cccggtgcta aggccgctt aattggtcgtagcaagctctagcaccgcttaa acgcacgtacgcgctgtcta ccgcgttttaaccgccaata ggattactta ctagtctct aggcacgtgta agatatatacatcctgt''' | |||
I got this sequence from section 4.1 from [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WK7-4C2PXCN-4&_user=1550512&_coverDate=05%2F07%2F2004&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000053660&_version=1&_urlVersion=0&_userid=1550512&md5=b7197090f87687529e7682ddcc04cbab&searchtype=a#secx10 here]. | |||
Once I get a quote I will ask for the vector sequence so that I can plan the PCR reaction. | Once I get a quote I will ask for the vector sequence so that I can plan the PCR reaction. | ||
Revision as of 23:21, 17 December 2010
Quick Navigation: Pages by Category | List of All Pages | Protocols
I got the go ahead to get the DNA 2.0 plasmid. So I have to design oligo that will be embedded in the vector.
Plasmid Design
I will get a 5kb vector from DNA 2.0 and have them add the sequence:
- 5' - CCAACGATCTGG
which produces the overhang CGAT, which is complementary to our adapter duplex. I'm allowed for anything up to 300bp (because it is the same price) so I'm pondering if I should add more too it or not. Right now I'm going with no and am requesting a quote. If I did add more what would it be?
For shits and giggles I'm going to add a SapI recognition site in before the BstXI site, This sequence would be:
- 5' - GCTCTTCCAGCTC
Because of the nature SapI it will leave a 5' overhang of AGC (cutting right after the CC above) which can be ligated onto the adapter duplex for unzipping.
Koch also wants me to add the high-affinity nucleosome binding site. I'm not sure this is what I need but:
- 5' - ctggagata cccggtgcta aggccgctt aattggtcgtagcaagctctagcaccgcttaa acgcacgtacgcgctgtcta ccgcgttttaaccgccaata ggattactta ctagtctct aggcacgtgta agatatatacatcctgt
I got this sequence from section 4.1 from here.
Once I get a quote I will ask for the vector sequence so that I can plan the PCR reaction.
The vector sequence can be found here:
/BstXI Custom Plasmid Sequence - this thing should have a cool name. How about Plasmid Destroyer 8003? I could name it Vector Sigma in honor of transformers, but that is gay. I know, IheartPlasmid... yea!
PCR Design
The plasmid I want is 5kb. I want to design 2 PCR reactions, but 1 at first. The first one will be 4kb with the forward primer containing the dig molecule and the reverse primer will contain a biotin and will anneal about 10 bp from the BstXI site. This way the site can be cleaved with BstXI if I want to do unzipping constructs or the molecule can be stretched if I want to go straight into tethering. I think this also allows for the attempt at ligation on a slide or restriction on a slide which could be a cool experiment.
I want the reverse primer close to the cut site so that when I use the PCR cleanup kit, the digested piece will go right through the membrane without doing a gel slice. I also want the PCR to yield a 4kb fragment so that tethering works with both big and small beads. With the short fragment, tethering isn't all that efficient when dealing with big beads.