User:Bill Flanagan

From OpenWetWare
Revision as of 21:45, 11 September 2009 by Bill Flanagan (talk | contribs) (Wired)
Jump to navigationJump to search

My name is Bill Flanagan.


I'm the Senior Technology Developer for OpenWetWare.

I work for MIT in the Department of Biological Engineering.

My background is in building online systems to facilitate collaboration.


Contact

  • For OWW logged-in members: Click Here
  • Email: bill at openwetware dot org

Google Docs

<GoogleDocs />

Annotation

Neo Note

Suggestions for a Global Shared Scholarly Annotation System

D-Lib Magazine
May/June 2009
Volume 15 Number 5/6

ISSN 1082-9873
NeoNote
Suggestions for a Global Shared Scholarly Annotation System

Bradley Hemminger, Ph.D.
Associate Professor
School of Information and Library Science
University of North Carolina, Chapel Hill
<bmh@ils.unc.edu>

Abstract

There is a need for integrated support for annotation and sharing within the primary tool used for interacting with the World Wide Web, which today is a web browser. Based on prior work and user studies in our research lab, we1 propose design recommendations for a global shared annotation system, for the domain of scholarly research. We describe a system built using these design recommendations (NeoNote), and provide an example video demonstrating the suggested features. Finally, we discuss the major challenges that remain for implementing a global annotation system for sharing scholarly knowledge.


PDF Annotation

Free means to annotate (comment) a PDF?

Posted Dec 2, 2004 19:02 UTC (Thu) by d.e.cox (guest, #3912)

Parent article: The Grumpy Editor's Guide to PDF Viewers

I haven't found a free means to annotate (add little yellow comment boxes) to PDFs. I've used this feature of Adobe's products quite a bit, and it looks to be one of the major improvements in acrobat 7. Anyone know if this kind of capability is in the pipeline of the free readers xpdf, ggv, etc?

Wired

The End of Theory: The Data Deluge Makes the Scientific Method Obsolete

WIRED MAGAZINE: 16.07 Science: Discoveries RSS The End of Theory: The Data Deluge Makes the Scientific Method Obsolete By Chris Anderson Email 06.23.08

"Speaking at the O'Reilly Emerging Technology Conference this past March, Peter Norvig, Google's research director, offered an update to George Box's maxim: "All models are wrong, and increasingly you can succeed without them."

...

"In February, the National Science Foundation announced the Cluster Exploratory, a program that funds research designed to run on a large-scale distributed computing platform developed by Google and IBM in conjunction with six pilot universities."

Information seeking behavior of academic scientists

Research Article

Information seeking behavior of academic scientists

Bradley M. Hemminger 1, Dihui Lu 2, K.T.L. Vaughan 3, Stephanie J. Adams 4

206A Manning Hall, SILS, School of Information and Library Science, University of North Carolina at Chapel Hill, NC. 27599-3360

School of Information and Library Science, University of North Carolina at Chapel Hill

Health Sciences Library, University of North Carolina at Chapel Hill

School of Information and Library Science, University of North Carolina at Chapel Hill

email: Bradley M. Hemminger (bmh@ils.unc.edu)

Index Terms

information seeking • scholars • information resources • electronic publications • online databases

Abstract

The information seeking behavior of academic scientists is being transformed by the availability of electronic resources for searching, retrieving, and reading scholarly materials. A census survey was conducted of academic science researchers at the University of North Carolina at Chapel Hill to capture their current information seeking behavior. Nine hundred two subjects (26%) completed responses to a 15-minute Web-based survey. The survey questions were designed to quantify the transition to electronic communications and how this affects different aspects of information seeking. Significant changes in information seeking behavior were found, including increased reliance on web based resources, fewer visits to the library, and almost entirely electronic communication of information. The results can guide libraries and other information service organizations as they adapt to meet the needs of today's information searchers. Simple descriptive statistics are reported for the individual questions. Additionally, analysis of results is broken out by basic science and medical science departments. The survey tool and protocol used in this study have been adopted for use in a nationwide survey of the information seeking behavior of academic scientists. Received: 14 July 2006; Revised: 14 February 2007; Accepted: 15 February 2007

Digital Object Identifier (DOI)

DOI: 10.1002/asi.20686

Wiki1001

Site URL: http://www.wiki1001.com
OWW Page: http://www.wiki1001.com/wiki/25

Wiki1001.com tracks Internet Wikis. OpenWetWare.org was added recently to it. Take a look at the site. Feel free to say something about OWW (great, good, or otherwise!)

BioBricks

BBa J22001

PMID 123456


>BBa_J22001 Part-only sequence (2630 bp) <dnaseq> aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggaaagtactagatgattaaccgtatccgc gtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagct ttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgcgcattaacctgagtcgttcagcggtacg gatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaa ttcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgatt acctagattatggcaatactggagcttatttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtga aaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctg gtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctga ccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatgcaacgctctttgactgacaccgtcactcatgtccgcgaaggttcaga tgccatctatgccggtacccgtgaaattgcggcgggcaacaccgatctttcctcccgtactgaacagcaggcatccgcgctggaagaaactgccgccagc atggagcagctcaccgcgacagtgaagcaaaacgccgataacgcccgccaggcctcgcaactggcgcaaagtgcctccgacaccgcccagcacggcggca aagtggtggatggcgtagtgaaaacgatgcatgagatcgccgatagttcgaagaaaattgccgacattatcagcgttatcgacggtattgccttccagac taatatcctcgcgctgaatgccgcggttgaagccgcgcgtgcgggtgaacagggccgtggttttgccgtggtggcgggtgaagtgcgtaatcttgccagt cgcagcgcccaggcggcaaaagagatcaaagccctcattgaagactccgtctcacgcgttgataccggttcggtgctggtcgaaagcgccggggaaacaa tgaacaatatcgtcaatgctgtcactcgcgtgactgacattatgggcgagattgcatcggcatcggatgaacagagccgtggcatcgatcaagtcgcatt ggcggtttcggaaatggatcgcgtcacgcaacagaacgcatcgctggtgcaggaatcagctgccgccgccgctgcgctggaagaacaggcgagtcgttta acgcaagcagtttccgcgttccgtctggcagccagcccactcaccaataaaccgcaaacaccatcccgtcctgccagtgagcaaccaccggctcagccac gactgcgaattgctgaacaagatccaaactgggaaacattttgatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcacc ggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctga ccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccga ccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgc gccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt acaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgt gcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaa gaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactaga gccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct caccttcgggtgggcctttctgcgtttata </dnaseq>

Barcodes

References

Examples

Absolute pagename: Generate a simple barcode

<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=http://openwetware.org/wiki/User:Bill Flanagan&choe=UTF-8' /> </html>

<html> <img src='http://chart.apis.google.com/chart?chs=150x150&cht=qr&chl=User:Bill Flanagan&choe=UTF-8' /> </html>

Use OWW FULLPAGENAME to generate the pagename:

Size: 100x100

<html> <img src='http://chart.apis.google.com/chart?chs=100x100&cht=qr&chl=http://openwetware.org/wiki/</html>User:Bill Flanagan<html>&choe=UTF-8' /> </html>

Neural Networks

References

Prediction of the response under impact of steel armours using a multilayer perceptron

Impact Time and Point Predicted Using a Neural Extended Kalman Filter

Ballistic Performance Evaluation of Multi-layered Armors using Neural Network Algorithm

Prediction of the behaviour of CFRPs against high-velocity impact of solids employing an artificial neural network methodology

Underground blast induced ground shock and its modelling using artificial neural network

Rankine–Hugoniot equation

Wikipedia: Neural Network

User:Bill Flanagan/docs/Multi-touch screens and neural networks

Error Backpropagation Neural Calibration and Kalman Filter Position Estimation for Touch Panels

Terms

[neural extended]

[Kalman filter]

[multilayered perceptron]

[artificial neural network]

[Rankine-Hugoniot]

AI

Why AI Failed

BioJava

Link: BioJava

BioJava is dedicated to providing a Java framework for processing biological data. It include objects for manipulating biological sequences, file parsers, DAS client and server support, access to BioSQL and Ensembl databases, tools for making sequence analysis GUIs and powerful analysis and statistical routines including a dynamic programming toolkit.

BioJava is used in several real-world bioinformatics applications and has been used for bioinformatics analysis in a number of published studies.

Bitnami

Link: Bitnami

MediaWiki Extension Matrix

Link: Mediawiki Extension Matrix

PHP Tube: PHP Upload class for YouTube

Link: [1]

MediaWiki: Magic Words

Link: Magic Words

DNASis SmartNote

MiraiBio has introduced a free lab notebook on their site free for all users.

You can check it out here.

It's well worth a look.

SmartNote is a bona-fide Web 2.0 application. It relies heavily on Javascript using the Dojo.js Javascript library for much of its interaction. It has many "snap-in" tools for doing analysis of DNA sequences. One of the nice features it has is a genome annotation tool. I'm particularly interested in people's reactions to this particular feature. This is their contact information:

MiraiBio (a Hitachi subsidiary) 601 Gateway Blvd. Suite 100 South San Francisco, CA 94080 800-624-6176 www.miraibio.com

Intro Books on Bioinformatics and PCR

(todo: reformat via biblio/cite with isbn numbers, etc)

From: Aaron Hicks

From: Felix:


From: Michael Vieths

Other:

Quasi-Public-Accessible Biology Lab Facilities

(New content: to be moved to appropriate pages when I have time)

Wake Forest: Babcock Demon Incubator

North Carolina

Website: wfubdi.org/bioscience.php

The incubator can provide fully equipped shared wet lab space for early stage bioscience companies. The wet lab space is located in the Piedmont Triad Research Park. The facilities include chemistry and tissue hoods, gas, air, materials disposal, internet access, etc. A partial list of equipment in the lab can be found on the facilities page. In addition to the use of the wet lab, incubator clients can use break room facilities and schedule conference rooms as required.

Equipment:

  • LCMS, single quad / UPLC system with PDA detector, auto-sampler and column heater
  • UPLC system with PDA detector, auto-sampler, column heater and peptide platform
  • Alliance HPLC system with UV/Vis detector, degas system and column heater
  • GC - 2010, auto injection system
  • Nitrogen Generator – 30 L /min
  • UPS system – 5.2 KV
  • Empower software
  • Classic LAC/E32 Server
  • Oilless vacuum Pump

North Carolina Community College BioNetwork Pharmaceutical Center (NCCBNC)

http://www.ncbionetwork.org/index.cfm?dir=Pharmaceutical/center.cfm&sec=4

The BioNetwork Pharmaceutical Center operates as a collaborative venture between Forsyth Technical Community College and Guilford Technical Community College to serve all community colleges in the state. The administrative offices of the Pharmaceutical Center are located in the Piedmont Triad Research Park.

The Pharmaceutical Center is a statewide liaison between pharmaceutical manufacturing needs and worker training. The Center provides leadership in general pharmaceutical manufacturing to improve the quality of learning, training and services at all NC community colleges and to recruit students for their programs.

The Center also works with economic development leaders in the state to help recruit new companies to North Carolina.

The Center coordinates funded innovation and equipment facility projects as individual colleges expand and enhance the capacity of NC community colleges to educate and train individuals in the biotechnology industry

Just like the NCCCS, the Pharmaceutical Center has partners in industry, commerce, economic development organizations, secondary education, public and private colleges and universities.

Lab Equipment Categories

  • Lab Equipment
  • Analytical Instruments
  • Autoclaves & Sterilizers
  • Centrifuges & Parts
    • Centrifuges
    • Rotors & Parts
    • Other
  • Cleaning Equipment
  • Evaporators
  • Fermenters
  • Furnishings & Facilities
  • Heating & Cooling
    • Burners & Hotplates
    • Cryogenics
    • Environmental Chambers
    • Freezers & Fridges
    • Heating Mantles
    • Hoods
    • Laboratory Furnaces
    • Laboratory Ovens
    • Temperature Monitoring
    • Water Baths & Chillers
    • Other
  • Incubators
  • Lab Lasers & Photonics
  • Lab Scales & Balances
    • Digital Scales & Balances
    • Mechanical & Beam Balances
    • Weights & Calibration Sets
    • Other
  • Microscopes
  • Microscope Parts & Accessories
  • Microtomes
  • Mixers
  • Motion Control
  • Power Supply
  • Pumps
  • Recorders & Plotters
  • Shakers
  • Stirrers
  • Others

Recent Biobricks

<xfeeds>http://partsregistry.org/wiki/index.php?title=Special:Recentchanges&feed=rss</xfeeds>

Representative PCR Models

Perkin Elmer GeneAmp 2400 PCR System Thermal Cycler Perkin Elmer GeneAmp 7500 Realtime Perkin Elmer GeneAmp 9600 Perkin Elmer GeneAmp 9700 Perkin-Elmer GeneAmp 1000 Perkin Elmer Prism 7700 Perkin Elmer Cetus 480 DNA Thermal Cycler Mini Horizontal Electrophoresis PCR Agarose Gel System NewGeneAmp 9600 Thermal Cycler Stratagene Thermocycler model SCS-2 Techne TouchGene Gradient 96 Well Thermal Cycler Techne Genius FGEN02TP Thermal Cycler Hybaid TR3 Omnigene Thermal Cycler Sigma-Aldrich Alumaseal 96 film adhesive plates Biometra Trio-Thermoblock TB-1 Thermocycler Ericomp TwinBlock EZ Thermal Cycler THERMOLYNE BARNSTEAD TEMP-TRONICTHERMAL CYCLER ERICOMP EZ SINGLEBLOCK Thermal Cycler ERICOMP EZ POWERBLOCK II Thermal Cycler Hybaid Omnislide System PCR Thermal Cycler Eppendorf Mastercycler 96 Watt GradientThermal Cycler COY Model 50 TempCycler 35-Well Temperature Cycler

Message

Reference section for Dr. Elana Vanderlay still under construction.

Watch this space for exciting developments.


Test Categories