Knight:Evolving Reshmaverters/Promoter library design
From OpenWetWare
Promoter library design
In progress!
Promoter architecture
-35 -10 +1
______ ______ _
----------------TTGACA-----------------TATAAT----- CA------------------- (consensus)
----------------TTGCTT-----------------TATAAT-GATT CATAAATTTGAGAGAGGAGTT (good promoter clearance?) [1]
----------------TTGACT-----------------GATACT------CA------------------- (repressible, low KON?)[2]
----------------TTGACCccacgcgtggg------TATAAT----- CA------------------- (operator site in position of maximum steric interference with RNAP)[3, 4, 5] ----------------TTGACA---------CccacgcgTGGGAT----- CA------------------- (operator site in position of maximum steric interference with RNAP)[3, 4, 5]
Constant promoter
-35 -10 +1
______ ______ _
tttatcaaaaagagtgTTGATCccacgcgtgggatatagGATACTtagattcataaatttgagagaggagtt (promoter9)
tttatcaaaaagagtgTTGACAtttttaagtcccacgcgTGGGATtagattcataaatttgagagaggagtt (promoter8)
Questions
- Do I include too much extraneous sequence? These promoters are longer to reflect those found in papers.
Libraries
-35 -10 +1
______ ______ _
tttatcaaaaagagtgTTGNTCccacgcgtgggannnnnNATANTnnnnnncannnnnnnnnn (based on promoter9)
tttatcaaaaagagtgTTGACAnnnnnnnntcccacgcgTGGGATnnnnnncannnnnnnnnn (based on promoter8)
nnnnnnnnnTTGNCAnnntcccacgcgcgtggGATANTnnnnnnca (based on BBa_R2000)
Questions
- Are these promoters likely to be functional? Too much sequence diversity?
- I potentially don't need to vary the -35 and -10 from consensus because I can still achieve a range of promoter strengths without changing them. [6]
Operator
0 site operator: cccacgcgcgtggg (14bp) -2 site operator: cccacgc gtggg (12bp) (higher affinity)
Brainstorming
How could these regulatory regions be redesigned to be repressible?
Comments welcome
- Repressor sites tend to fall between the -35 and -10 regions and/or downstream of the -10 (around the +1). (Not upstream of the -35). [7, 8]
- Binding of the repressor dimer to the promoter may lead to DNA bending rendering binding of more dimers unfavorable. Perhaps a single binding site is preferable?
- The TG sequence at -16 is causing the regulatory regions to be too strong in the derepressed state. The RNA polymerase is "winning" the competition for binding with the repressor. Perhaps this dinucleotide should be removed. [9, 10]
- A high kON (rate of complex formation between RNA polymerase and promoter) correlates inversely with repressibility. High kON may result in RNAP outcompeting the repressor for the regulatory region binding. High regulatory region clearance rates enable strong transcription initiation and allow for repressor binding.[2]
- +1 base should be an A with 6-7 bases between end of -10 hexamer and +1. [1, 2]
- Use the -2 operator site because it binds the homodimer more tightly. (But it is less modular).
- How can we design promoters with low kON but high clearance rates for improved repressibility?
Existing promoters
The following promoters have been tested and are not repressible under my testing conditions.
Heterodimers:
-35 -10
Promoter1 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTgagcaca
Promoter2* TTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter3 cacgtgtgcgtgggTTGACAcgtgtgcgtgggaagtcGATACTtagattcacgtgtgcgtggg
Promoter4 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTgagcaca
Promoter5 TTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg
Promoter6 cacgtgtgcgtgggTTGACAcacgtgtgcgtgggaatGATACTtagattcacgtgtgcgtggg
Homodimers:
-35 -10
BBa_R2000 agtttattcTTGACAtggtcccacgcgcgtggGATACTacgtcag
BBa_R2001 agtttattcTTGACAtggtcatattacggtgaGATACTcccacgcgcgtggg
BBa_R2002 agtttattcTTGACAtggtcccacgcgcgtggGATACTcccacgcgcgtggg
References
Promoter design
- Kammerer W, Deuschle U, Gentz R, and Bujard H. Functional dissection of Escherichia coli promoters: information in the transcribed region is involved in late steps of the overall process. EMBO J. 1986 Nov;5(11):2995-3000. DOI:10.1002/j.1460-2075.1986.tb04597.x |
- Lanzer M and Bujard H. Promoters largely determine the efficiency of repressor action. Proc Natl Acad Sci U S A. 1988 Dec;85(23):8973-7. DOI:10.1073/pnas.85.23.8973 |
- Collado-Vides J, Magasanik B, and Gralla JD. Control site location and transcriptional regulation in Escherichia coli. Microbiol Rev. 1991 Sep;55(3):371-94. DOI:10.1128/mr.55.3.371-394.1991 |
- Gralla JD. Transcriptional control--lessons from an E. coli promoter data base. Cell. 1991 Aug 9;66(3):415-8. DOI:10.1016/0092-8674(81)90001-5 |
- Burr T, Mitchell J, Kolb A, Minchin S, and Busby S. DNA sequence elements located immediately upstream of the -10 hexamer in Escherichia coli promoters: a systematic study. Nucleic Acids Res. 2000 May 1;28(9):1864-70. DOI:10.1093/nar/28.9.1864 |
- Voskuil MI, Voepel K, and Chambliss GH. The -16 region, a vital sequence for the utilization of a promoter in Bacillus subtilis and Escherichia coli. Mol Microbiol. 1995 Jul;17(2):271-9. DOI:10.1111/j.1365-2958.1995.mmi_17020271.x |
- Ellinger T, Behnke D, Bujard H, and Gralla JD. Stalling of Escherichia coli RNA polymerase in the +6 to +12 region in vivo is associated with tight binding to consensus promoter elements. J Mol Biol. 1994 Jun 17;239(4):455-65. DOI:10.1006/jmbi.1994.1388 |
- Lutz R and Bujard H. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. DOI:10.1093/nar/25.6.1203 |
- Besse M, von Wilcken-Bergmann B, and Müller-Hill B. Synthetic lac operator mediates repression through lac repressor when introduced upstream and downstream from lac promoter. EMBO J. 1986 Jun;5(6):1377-81. DOI:10.1002/j.1460-2075.1986.tb04370.x |
Structures
- Wolfe SA, Ramm EI, and Pabo CO. Combining structure-based design with phage display to create new Cys(2)His(2) zinc finger dimers. Structure. 2000 Jul 15;8(7):739-50. DOI:10.1016/s0969-2126(00)00161-1 |
- Murakami KS, Masuda S, and Darst SA. Structural basis of transcription initiation: RNA polymerase holoenzyme at 4 A resolution. Science. 2002 May 17;296(5571):1280-4. DOI:10.1126/science.1069594 |
- Murakami KS, Masuda S, Campbell EA, Muzzin O, and Darst SA. Structural basis of transcription initiation: an RNA polymerase holoenzyme-DNA complex. Science. 2002 May 17;296(5571):1285-90. DOI:10.1126/science.1069595 |
Promoter libraries
- Hammer K, Mijakovic I, and Jensen PR. Synthetic promoter libraries--tuning of gene expression. Trends Biotechnol. 2006 Feb;24(2):53-5. DOI:10.1016/j.tibtech.2005.12.003 |
- Alper H, Miyaoku K, and Stephanopoulos G. Characterization of lycopene-overproducing E. coli strains in high cell density fermentations. Appl Microbiol Biotechnol. 2006 Oct;72(5):968-74. DOI:10.1007/s00253-006-0357-y |
- Fischer CR, Alper H, Nevoigt E, Jensen KL, and Stephanopoulos G. Response to Hammer et al.: Tuning genetic control--importance of thorough promoter characterization versus generating promoter diversity. Trends Biotechnol. 2006 Feb;24(2):55-6. DOI:10.1016/j.tibtech.2005.12.001 |