BME100 f2013:W900 Group5 L6
| Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help | ||||||
OUR COMPANY
LAB 6 WRITE-UPComputer-Aided DesignTinkerCAD We used TinkerCAD to make improvements on the PCR test tubes. We made each test tube about 20% longer and labeled the caps of each tube. One row is red with the numbers zero through three and the other row is blue with the same numbers. We also a stamp that will hold the test tubes completely off the ground so that there is no wobbling when working with them. http://openwetware.org/images/4/4c/Tinkercad_pic_-1_for_BME_100.png
Using TinkerCAD to design and print out a specialized camera holder would make the design of the experiment optimal. By personalizing the camera holder, the camera being used will be fitted more efficiently, making the possibility of error (e.g. by bumping the camera and shifting it in open space on the general camera holder) less.
Feature 1: Cancer SNP-Specific PrimersBackground on the cancer-associated mutation
- GGAAGTGGGTCCTAAAAACTCTTACA
- TGCATACATAGAAGATCACAGTGGC
Feature 2: Consumables KitThe consumables that will be provided the box will go as follows:
Feature 3: PCR Machine Hardware[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.] The PCR unit will come pre-assembled, to allow for quick start in one's lab.
A major issue found in the OpenPCR machine was that the computer software did not communicate well with the unit. To fix this issue, our software is built into a small computer that is on the PCR unit itself, eliminating the need for external computer systems to communicate with the unit that is already running tests. In addition, due to inconsistent heating among several PCR machines used, we have designed a uniform heating unit in the PCR machine that will more efficiently heat the samples put into the machine; this will also speed up the process of the lab itself.
Feature 4: Fluorimeter HardwareEssentially the redesigned fluorimeter would be readily and easily included within the system. This is ue to the accessibility of the new and compact design that would enhance the amount of workspace needed to conduct these experiments. The whole purpose of the system is to maximize the total efficiency from every angle and eliminate any errors that could cause faulty results.
A major weakness that was spotted within the fluorimeter was that achieving a picture, and coordinating the lid drop to shield the light was a major problem. What the group decided to do was design a box similar to the one that has been used within the lab. The box would instead have a button that could be pressed to easily take a picture in the dark without having to time it perfectly. What would have to be done is mount a camera on the fluorimeter or where the camera mount was originally designed to be placed. From that vantage point a clear image could be taken, it would however be slightly more costly, however, the improvement and lack of errors would be substantial due to the fact that the use of the fluorimeter for this particular set up was determining a cancer sequence or genome. This really drove the group to proceed with making a full proof device that would function properly and without and troublesome miscommunications as well. |
||||||







