840:153g:Projects/project4/2009/03/11: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 12: Line 12:
* The primers that have been used were determined to form hairpins and dimers with highly negative ΔG values. This was found to be primarily due to the sequences of the prefix and suffix. However, the following primers are proposed, which eliminate hairpins at operating temperature, and reduces the number of dimers that can be formed. The mutations, shown in parantheses, will not interfere with the amino acid sequence.
* The primers that have been used were determined to form hairpins and dimers with highly negative ΔG values. This was found to be primarily due to the sequences of the prefix and suffix. However, the following primers are proposed, which eliminate hairpins at operating temperature, and reduces the number of dimers that can be formed. The mutations, shown in parantheses, will not interfere with the amino acid sequence.
     Forward Primer:
     Forward Primer:
         5’ TAGAATTCGCGGCCGCTTCTAG ATGAG(G)AGCAAAAAATTGTGG
         5’ TAGAATTCGCGGCCGCTTCTAG TAGAG(G)AGCAAAAAATTGTGG


     Reverse Primer:
     Reverse Primer:

Revision as of 14:55, 12 March 2009

MoldBusters' Journal <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Wednesday 3/11

Josh, Katy, and Oggie

  • The Bacillus subtilis showed significant growth, forming a lawn of cells around both locations the filter paper was placed.
  • Cells from four areas of the lawns were streaked onto a sectioned LB plate, and incubated.
  • Two liquid cultures containing TSB broth were inoculated with the growing cells.
  • The primers that have been used were determined to form hairpins and dimers with highly negative ΔG values. This was found to be primarily due to the sequences of the prefix and suffix. However, the following primers are proposed, which eliminate hairpins at operating temperature, and reduces the number of dimers that can be formed. The mutations, shown in parantheses, will not interfere with the amino acid sequence.
   Forward Primer:
        5’ TAGAATTCGCGGCCGCTTCTAG TAGAG(G)AGCAAAAAATTGTGG
   Reverse Primer:
        5’ ATCTGCAGCGGCCGCTACTAGTA TTATTGTGCAGC(A)GCTTGTAC