840:153g:Projects/project4/2009/03/12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 8: Line 8:
''Oggie''
''Oggie''
*Designed primers for neutral protease gene of ''B. subtilis''
*Designed primers for neutral protease gene of ''B. subtilis''
*Gene will be used to test the extracted DNA
*Gene will be used to test the extracted DNA's and as a backup if aprE can't be cloned again
*The following primers will be used to clone the '''entire''' protease gene
*The following primers will be used to clone the '''entire''' protease gene



Revision as of 13:47, 12 March 2009

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Thursday 3/12

Oggie

  • Designed primers for neutral protease gene of B. subtilis
  • Gene will be used to test the extracted DNA's and as a backup if aprE can't be cloned again
  • The following primers will be used to clone the entire protease gene
   Forward Primer:
        5’ [ATGAATTCGCGGCCGCTTCTAG]ATGGGTTTAGGTAAGAAATT
   Reverse Primer:
        5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA
  • The following primers will be used to clone just the mature product of the protease gene
   Forward Primer:
        5’ [ATGAATTCGCGGCCGCTTCTAG]ATGGCCGCCGCCACTGGAA
   Reverse Primer:
        5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA


/