840:153g:Projects/project4/2009/03/12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 33: Line 33:
* After break, the DNA will be run on a gel to determine if it is ready for use in the aprE gene amplification.
* After break, the DNA will be run on a gel to determine if it is ready for use in the aprE gene amplification.


Derek and Katy
''Derek and Katy''
* Ran a PCR amplification of wintergreen as a backup plan since we are running into problems with our original project.
* Ran a PCR amplification of wintergreen as a backup plan since we are running into problems with our original project.
* Made glycerol stocks for Bacillus subtilis strain 168.
* Made glycerol stocks for Bacillus subtilis strain 168.  
 
''Josh''
* I found some more information on the neutral protease Oggie was looking into. The protein's general name is Bacillolysin, and the gene name is nprE. More information was found at [http://www.uniprot.org/uniprot/P68736]
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
|}
|}

Revision as of 14:19, 13 March 2009

MoldBusters' Journal <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Thursday 3/12

Oggie

  • Designed primers for neutral protease gene of B. subtilis strain 168
  • Gene will be used to test the extracted DNA's and as a backup if aprE (alkaline protease subtilisin) can't be cloned again
  • The following primers will be used to clone the entire protease gene
   Forward Primer:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGGTTTAGGTAAGAAATT

   Reverse Primer:
        5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA
  • The following primers will be used to clone just the mature product of the protease gene
   Forward Primer Mature:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGCCGCCGCCACTGGAA
  • The following mutated primer will be used if the previous forward primer doesn't work
   Forward Primer Mature C-A mutated:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGC(A)GCCGCCACTGGAA


Josh and Casy

  • Used two liquid cultures of the Bacillus subtilis for genomic DNA extraction, following the protocol from Bionet.
  • Stored the four DNA samples at room temperature in isopropanol.
  • After break, the DNA will be run on a gel to determine if it is ready for use in the aprE gene amplification.

Derek and Katy

  • Ran a PCR amplification of wintergreen as a backup plan since we are running into problems with our original project.
  • Made glycerol stocks for Bacillus subtilis strain 168.

Josh

  • I found some more information on the neutral protease Oggie was looking into. The protein's general name is Bacillolysin, and the gene name is nprE. More information was found at [1]
Retrieved from "https://openwetware.org/mediawiki/index.php?title=840:153g:Projects/project4/2009/03/12&oldid=293707"