BME100 f2013:W1200 Group14 L6: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 70: Line 70:




== Packaging ==<br>
<br>
We will package the consumables in styrofoam to prevent damage of the materials during transportation of the kit and to make identifying and repackaging of the materials simple for the consumer. Each part of the kit will be neatly labeled and arranged in a way that is intuitive for people looking to use the system but also efficient and space effective. All parts of the kit will packaged in a single box with information on each part of the kit. The box will clearly label it's content and will have our logo. Our target audience is anyone looking for a simple, intuitive way to analyze DNA sequences. The reagent bottles will be clearly labeled and color coded so there is no confusion for anyone trying to use the kit. We will include an easy disposal container for pipette tips with a narrow opening to prevent any spills that could happen with a disposal container found at home (such as a plastic cup).
We will package the consumables in styrofoam to prevent damage of the materials during transportation of the kit and to make identifying and repackaging of the materials simple for the consumer. Each part of the kit will be neatly labeled and arranged in a way that is intuitive for people looking to use the system but also efficient and space effective. All parts of the kit will packaged in a single box with information on each part of the kit. The box will clearly label it's content and will have our logo. Our target audience is anyone looking for a simple, intuitive way to analyze DNA sequences. The reagent bottles will be clearly labeled and color coded so there is no confusion for anyone trying to use the kit. We will include an easy disposal container for pipette tips with a narrow opening to prevent any spills that could happen with a disposal container found at home (such as a plastic cup).
<br>
<br>

Revision as of 00:57, 26 November 2013

BME 100 Fall 2013 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR COMPANY

Name: Minh Pham
Name: Brianna Schilling
Name: Ashley Powell
Name: student
Name: student




LAB 6 WRITE-UP

Computer-Aided Design

TinkerCAD

The TinkerCAD is a 3D modeling program that has the ability to form and mold into any product. With this program, one can quickly design and print a 3D product. We used this program's simple shapes to construct improvements. We were provided PCR tubes and with the tinker tools, we redesigned it and changed many aspects. We decided to add connectors between the individual tubes, color coding, and strips where one cold right on to improve organization.

Implications of Using TinkerCAD for Design

With the use of tinkercad, an OpenPCR machine can be improved drastically. If a piece was damaged, one could quickly be made to the correct specifications using any material. 3D printers do not only print plastic, they can print objects using various hard substances. The tinkercad program can recreate the internals and outer casing of the PCR machine. It currently cannot make circuit boards, but can definitely make the PCR tube holder, the lid, circuit board cases, and screws. It would be best not to make the newly designed PCR machine out of plastic because PCR machines can really heat up. Instead of reconstructing a new machine each time and waiting for different parts from different manufacturers, the 3D printer can mostly everything done in one room, which will reduce cost and time.

Feature 1: Cancer SNP-Specific Primers

[Instructions: This information will come from the Week 9 exercises you did in lab. Your notes should be in a pdf file that is saved on Blackboard under your group.]

Background on the cancer-associated mutation

[Instructions: Use the answers from questions 3, 4, 5, and 7 to compose, in your own words, a paragraph about rs17879961] This lab focused on cancer-SNP's. The building blocks of DNA are called nucleotides, which are basically the subunits of the nucleic acids that make up DNA. Within a DNA sequence, there can by polymorphisms, which are variances in the DNA sequence. This SNP in particular is found in the DNA of homo sapiens, or humans. This SNP is pathogenic. There is a total of 23 pairs of chromosomes in the human genome-- this SNP occurs on the 22nd chromosome. rs17879961 affects a gene which contains the gene CHEK2, which stands for checkpoint kinase 2. The purpose of this gene is to regulate the cell cycle, and to suppress the growth of tumors.


Primer design

  • Forward Primer: [Instructions: write the sequence of the forward primer]

Forward Primer: 5' - TGTAAGGACAGGACAAATTT Cancer-specific Reverse Primer: 5' - TGGGTCCTAAAAACTCTTAC

[Instructions: write the sequence of the forward primer]

How the primers work: [Instructions: explain what makes the primers cancer-sequence specific. In other words, explain why the primers will amplify DNA that contains the cancer-associated SNP rs17879961, and will not exponentially amplify DNA that has the non-cancer allele.]

Primers are specific to the cancer-specific because there are both forward and reverse primers, which limit the sequence that can be created. For example, because the forward primer signals the beginning of the replication process, and the reverse primer signals the end of the replication, so the part that is replicated is limited to the DNA that is between the sequence of the forward and the reverse primer.



Feature 2: Consumables Kit


We will package the consumables in styrofoam to prevent damage of the materials during transportation of the kit and to make identifying and repackaging of the materials simple for the consumer. Each part of the kit will be neatly labeled and arranged in a way that is intuitive for people looking to use the system but also efficient and space effective. All parts of the kit will packaged in a single box with information on each part of the kit. The box will clearly label it's content and will have our logo. Our target audience is anyone looking for a simple, intuitive way to analyze DNA sequences. The reagent bottles will be clearly labeled and color coded so there is no confusion for anyone trying to use the kit. We will include an easy disposal container for pipette tips with a narrow opening to prevent any spills that could happen with a disposal container found at home (such as a plastic cup).
Our group determined that the pipet tips could be packaged more efficiently if they were stacked on top of each other rather than just in a single plastic case per layer of tips. This will make them easier to access because they easily stack without getting stuck together. in order to prevent them from being easy to spill, they will be enclosed in a plastic container with a spring base to push the layers to the top as tips are used. We determined in the kit that we used that the SYBR Green container let in too much light and was deactivated quickly if not crudely covered in our groups. To prevent this, we propose that we use solid dark colored plastic for the containers to prevent the light from reaching the dye when the container is closed. We will also clearly state in our instruction manual that the dye needs to be handled with care to prevent the light from reaching the dye.

Feature 3: PCR Machine Hardware

[Instructions: Summarize how you will include the PCR machine in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really awesome and easy to score.]

[Instructions: IF your group has decided to redesign the PCR machine to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Feature 4: Fluorimeter Hardware

[Instructions: Summarize how you will include the fluorimeter in your system. You may add a schematic image. An image is OPTIONAL and will not get bonus points, but it will make your report look really REALLY awesome and easy to score.]

[Instructions: IF your group has decided to redesign the fluorimeter to address any major weakness discussed by your group or mentioned by others (see the Virtual Comment Board Powerpoint files on Blackboard, Lab Week 12) explain how in an additional paragraph.]


Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach

[Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of CHEK2 PCR for predicting cancer. Please do NOT type the actual numerical values here. Just refer to them as being "less than one" or "very small." The instructors will ask you to submit your actual calculations via e-mail. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]