Harvard:Biophysics 101/2007/03/13: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
ShawnDouglas (talk | contribs) (new tasks) |
(No difference)
|
Revision as of 11:16, 13 March 2007
Assignment Due Mar 15
Task 1
- Based on our discussions and assignments thus far, interpret this sequence (manually).
- Include a specific and detailed outline of what you did and why. Think about how each step could be implemented in python.
- Summarize your findings in "layman's terms", e.g. what would you, as a physician, tell your patient with this sequence?
>example1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC
Task 2
- Privately design your own sequence which could be used in an exercise similar to Task 1.
- It is important that everyone complete this in time for next class, as we will be collecting everyone's submissions for the next assignment.
Assignment Due Mar 20
- Write a script to automatically carry out the interpretation you performed manually.