Harvard:Biophysics 101/2007/03/13

From OpenWetWare

Jump to: navigation, search

Assignment Due Mar 15

Task 1

  • Based on our discussions and assignments thus far, interpret this sequence (manually).
  • Include a specific and detailed outline of what you did and why. Think about how each step could be implemented in python.
  • Summarize your findings in "layman's terms", e.g. what would you, as a physician, tell your patient with this sequence?
>example1                                                                      
CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG                    
CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA                    
CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC                    
CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT                    
ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG                    
CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC                    
GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC   

Task 2

  • Design your own query sequence which could be used in an exercise similar to Task 1.
  • Post your query sequence to your notebook page before class on March 15, but keep your solution private for now.
  • Make sure to use fasta format


Assignment Due Mar 20

  • Write a script to automatically carry out the interpretation you performed manually.
Personal tools