Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(fix raw html notebook nav)
 
(12 intermediate revisions by one other user not shown)
Line 2: Line 2:
|-
|-
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Haynes BioBrick Cloning</span>
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Haynes BioBrick Cloning</span>
|style="background-color: #F2F2F2" align="center"|<html><img src="/images/9/94/Report.png" border="0" /></html> [[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>[[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]]<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>}}
|style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]]&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;}}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}}
|-
|-
| colspan="2"|
| colspan="2"|
Line 65: Line 65:
*Using as Reference, discount gene names on left side
*Using as Reference, discount gene names on left side


 
==Primers==
*Created from Roche Applied Science https://www.roche-applied-science.com/shop/CategoryDisplay?catalogId=10001&tab=&identifier=Universal+Probe+Library&langId=-1#tab-3
{| class="wikitable" style="width: 800px;"
|- valign="top"
| '''PRIMERS LIST'''
{| width= 700px
|-
| &nbsp; || '''Roche Name''' || '''Left Primer''' || '''Right Primer''' || '''UPL probe'''
|-
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa || #78, cat.no. 04689011001
|-
| MAFA || NM_201589.3 || agcgagaagtgccaactcc || ttgtacaggtcccgctcttt || #39, cat.no. 04687973001
|-
| GLP1R || NM_002062.3 || gtggcggccaattactactg || ggccagcagtgtgtacagg || #22, cat.no. 04686969001
|-
| PCSK1 || NM_000439.4 || caagagcttgtgaaggacaaga || tctttcagccaagagcacag ||  #1, cat.no. 04684974001
|-
| IAPP || NM_000415.2 || ttaccaaattgtagaggctttcg || ccctgcctctatacactcactacc  ||  #77, cat.no. 04689003001
|-
| KCNQ2(4) || NM_172108.3 || gacgtcatcgagcagtactca || cccacgatctggtccact || #56, cat.no. 04688538001
|-
| GAPD (Ref) || NM_002046.3 || agccacatcgctcagacac || gcccaatacgaccaaatcc || #60, cat.no. 04688589001
|}
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}


__NOTOC__
__NOTOC__

Latest revision as of 23:30, 26 September 2017

Haynes BioBrick Cloning Main project page
Previous entry      Next entry

UPLassay

  • This is a test run for RT-PCR training. Using gene targets identified in prior research to pancreas differentiation gene sequences.

Reaction List

REACTION LIST
  Template cDNA Gene Target
Rxn 1: treated cells PDX1
Rxn 2: treated cells MAFA
Rxn 3: treated cells GLP1R
Rxn 4: treated cells PCSK1
Rxn 5: treated cells IAPP
Rxn 6: treated cells KCNQ2
Rxn 7: treated cells GAPD (reference gene)
Rxn 8: untreated cells PDX1
Rxn 9: untreated cells MAFA
Rxn 10: untreated cells GLP1R
Rxn 11: untreated cells PCSK1
Rxn 12: untreated cells IAPP
Rxn 13: untreated cells KCNQ2
Rxn 14: untreated cells GAPD (reference gene)
Rxn 15: no template PDX1
Rxn 16: no template MAFA
Rxn 17: no template GLP1R
Rxn 18: no template PCSK1
Rxn 19: no template IAPP
Rxn 20: no template KCN2Q
Rxn 21: no template GAPD (reference gene)
  • Run 3 Each
  • 45 Reactions Run
  • Using Variation 2

Variation 2
Figure 1

  • Using as Reference, discount gene names on left side

Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
PDX1 NM_000209.3 aagctcacgcgtggaaag gccgtgagatgtacttgttgaa #78, cat.no. 04689011001
MAFA NM_201589.3 agcgagaagtgccaactcc ttgtacaggtcccgctcttt #39, cat.no. 04687973001
GLP1R NM_002062.3 gtggcggccaattactactg ggccagcagtgtgtacagg #22, cat.no. 04686969001
PCSK1 NM_000439.4 caagagcttgtgaaggacaaga tctttcagccaagagcacag #1, cat.no. 04684974001
IAPP NM_000415.2 ttaccaaattgtagaggctttcg ccctgcctctatacactcactacc #77, cat.no. 04689003001
KCNQ2(4) NM_172108.3 gacgtcatcgagcagtactca cccacgatctggtccact #56, cat.no. 04688538001
GAPD (Ref) NM_002046.3 agccacatcgctcagacac gcccaatacgaccaaatcc #60, cat.no. 04688589001