Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
|||
Line 76: | Line 76: | ||
| PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa | | PDX1 || NM_000209.3 || aagctcacgcgtggaaag || gccgtgagatgtacttgttgaa | ||
|- | |- | ||
| | | MAFA: || treated cells || MAFA | ||
|- | |- | ||
| Rxn 3: || treated cells || GLP1R | | Rxn 3: || treated cells || GLP1R |
Revision as of 10:30, 4 November 2013
Haynes BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|