Haynes Lab:Notebook/David Barclay Undergrad Training/Plasmid Transformation/2013/10/27: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
Line 82: | Line 82: | ||
| PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac || #42, cat.no. 04688015001 | | PCSK1 || NM_013628.2 || tggagttgcatataattccaaagtt || agcctcaatggcatcagttac || #42, cat.no. 04688015001 | ||
|- | |- | ||
| IAPP || NM_010491.2 | | IAPP || NM_010491.2 || aatgatgtgcatctccaaactg || tggttcagtgccacagagag || #101, cat.no. 04692195001 | ||
|- | |- | ||
| KCNQ2 || NM_010611.2 | | KCNQ2 || NM_010611.2 || cacgcctacgtgttcctttta || cccctcagagctcttctcg || #2, cat.no. 04684982001 | ||
|- | |- | ||
| GAPD || NM_008084.2 | | GAPD (Ref) || NM_008084.2 || agcttgtcatcaacgggaag || tttgatgttagtggggtctcg || #9, cat.no. 04685075001 | ||
|} | |} | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> |
Revision as of 03:01, 7 November 2013
Haynes BioBrick Cloning | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UPLassay
Reaction List
|