IGEM:IMPERIAL/2007/Projects/In-Veso/Design: Difference between revisions
Peixuan Pey (talk | contribs) |
Peixuan Pey (talk | contribs) |
||
Line 38: | Line 38: | ||
*Comments: Untagged GFP behind a constitutive promoter. | *Comments: Untagged GFP behind a constitutive promoter. | ||
*DNA Available in the registry | *DNA Available in the registry | ||
[[Image:GFPstuff.bmp]] | |||
Line 50: | Line 52: | ||
*pT7 sequence from [http://www.ambion.com/techlib/basics/translation/index.html Ambion]: | *pT7 sequence from [http://www.ambion.com/techlib/basics/translation/index.html Ambion]: | ||
[[Image:T7_promoter.jpg]] | [[Image:T7_promoter.jpg]] | ||
===Arabinose -> pBad = GFP=== | |||
[[Image:AraBAD.bmp]] | |||
*Registry part: BBa_J5528 | |||
*Comments: Similar to part J5527 where mRFP is replaced with GFP | |||
*DNA Available in the registry | |||
== Preparation of E.coli Extracts == | == Preparation of E.coli Extracts == |
Revision as of 08:44, 31 July 2007
In-Veso Gene Expression: Design
Summary
Characerisation of the vesicle chassis will proceed in two stages.
Stage 1: In-vitro control experiments
- Establishes a platform for comparison of techniques
- Tests whether constructs and components are working
Stage 2: In-veso characterisation
For both stages, there are two preparatory steps that need to be carried out - preparing the DNA constructs to be tested, and preparing the chassis (solution or vesicles). Between the two stages, the only step that varies is the preparation of the chassis. Further, the only difference between the in-vitro and in-veso preparations is the additional step of creating vesicles. Both chassis will be using the same cell extracts. The DNA constructs and experiments will be the same for both stages.
Characterisation of the E.coli chassis will proceed in one stage, in parallel to the vesicle chassis characterisation. This will serve two purposes: first, it will provide a platform for comparison with the vesicle chassis; second, it will provide a contingency in case the vesicle chassis does not work.
DNA Constructs
pTet GFP
- Registry part: BBa_I13522
- Comments: Untagged GFP behind a constitutive promoter.
- DNA Available in the registry
T7 promoter
- Registry part: BBa_J34814
- T7 promoter sequence: gaatttaatacgactcactatagggaga
- Comments: T7 Promoter to be used qith t7 polymerase BBa_J34811
- DNA still in planning
- pT7 sequence from Ambion:
Arabinose -> pBad = GFP
- Registry part: BBa_J5528
- Comments: Similar to part J5527 where mRFP is replaced with GFP
- DNA Available in the registry
Preparation of E.coli Extracts
There are two choices for making cell extract from E.coli. One of them is S30, and the other is the S12 method, which is a more rapid and cost-effective preparation. The cell extracts can also be obtained from a manufacturer.
We have protocols for boths extracts, to be chosen depending on the E.coli strain that will be used:
A single batch of E.coli extract will be prepared for use in all experiments.
Commercially available E.coli S30 extract from Promega and Ambion:
- E.coli S30 extract system for circular DNA:
- L1020
- 278 GBP for 30 rxn
- E.coli T7 S30 extract system for circular DNA:
- 1130
- 278 GBP for 30 rxn
- E.coli S30 extract system for linear templates:
- 1030
- 278 GBP for 30 rxn
- PROTEINscript® II T7 linked transcription:translation kits for circular or linear DNA:
- AM1281/6
- 320 GBP for 40 rxn
- 100 GMP for 10 rxn
Formation of Vesicles
This step converts the in vitro expression system to the in veso expression system by encapsulating the E.coli cell extract in a phospholipid bilayer vesicle.
Experiments
The following chart cross-references the input variables to the dependent quantities. Each cell links to the protocol for that experiment. The number in each cell corresponds to the priority of that experiment.
Lifespan | Rate of Protein Synthesis |
PoPS Effect | Membrane Traffic | |
Temperature | 1 | 3 | ||
Media | 2 | 4 | ||
Parts | ||||
Piping |
Testing In Vitro system
1. Do both S30 and S12 extract on the K12 strain at 25°C.
2. Add E.coli and T7 RNA polymerases separately to each cell extract.
3. Make a reporter gene construct for GFP using pLux and T7 promoters respectively.
4. Mix gene contructs with S30 cell extracts.
*E.coli RNAP + pLux
*T7 RNAP + T7 promoter
5. Repeat step 4 with S12 cell extracts.
6. Measure fluorescence intensity at hourly intervals for 5 hours.
7. Determine the optimal translational activity of S30 and S12.
8. Choose which ever is best for strain K12.
9. Carry out subsequent experiments with the appropriate cell extract.
Testing Temperature Dependence
1. Carry out steps 2 to 6 at 4°C, 10°C, 15°C, 20°C, 25°C, 30°C, and 37°C; at pH 7.
2. Measure fluorescence intensity at hourly intervals for 5 hours.
Testing pH Dependence
1. Carry out steps 2 to 6 at pH 2, 4, 6, 7, 8, 10, 12; at 25°C.
2. Measure fluorescence intensity at hourly intervals for 5 hours.
Testing Lifespan of the system
Testing In Veso System
1. Follow the protocol for vesicle preparation in the "Design" section.
2. Repeat steps 2 to 6 above using only the optimal cell extract solution.
Testing for membrane trafficking and pore formation
1. Insert fluorescent markers BSA-rhodamine and UTP-fluorescein into the cell extract before vesicle formation.
2. Follow protocol for vesicle formation.
3. Observe fluorescence patterns in the feeding solution and vesicles.
Testing Temperature Dependence
1. Carry out steps 2 to 6 at 4°C, 10°C, 15°C, 20°C, 25°C, 30°C, and 37°C; at pH 7.
2. Measure fluorescence intensity at hourly intervals for 5 hours.
Testing pH Dependence
1. Carry out steps 2 to 6 at pH 2, 4, 6, 7, 8, 10, 12; at 25°C.
2. Measure fluorescence intensity at hourly intervals for 5 hours.
Testing Lifespan of the system
Materials Required
R9379 Rhodamine B isothiocyanate–Dextran from Sigma link
Information
RITC-Dextran
average mol wt ~70,000
MDL number MFCD00132176
Fluorescein-12-dUTP link
Fluorescein-12-2'-deoxy-uridine-5'-triphosphate (Fluorescein is bound to deoxyuridine triphosphate via an amide linkage. )
Serial no.: 11373242910
Amount: 25 nmol (25 µl)
Use fluorescein-12-dUTP to add a nonradioactive label to DNA. The labeled DNA can easily and safely be detected (e.g ., either directly or with an enzyme-conjugated anti-fluorescein).
Formula: C39H37N4O21P3Li4
Molecular weight: Mr = 1018.4 (fluorescein-12-dUTP-Li4)
P9511 3-sn-Phosphatidic acid sodium salt from egg yolk lecithin from Sigma link
≥98%
Synonym 1,2-Diacyl-sn-glycero-3-phosphate sodium salt
L-α-Phosphatidic acid sodium salt
PA
MDL number MFCD00063023
Prepared from L-α-phosphatidylcholine by hydrolysis with cabbage phospholipase D.
Schedule of Experiments
Grow E.coli strains --- prepare DNA constructs
E.coli experiments --- prepare E.coli extract
--- in-vitro experiments --- prepare vesicles
--- in-veso experiments
Protocols
ATP regenerating system
For preparation of the cell extract, we would want to use a cell-free protein synthesis system that is capable of using pyruvate as an energy source to produce high yields of protein. The Cytomim system, synthesizes chloramphenicol acetyltransferase (CAT) for up to 6 h in a batch reaction to yield 700 g/mL of protein. It provides a stable energy supply for protein expression without phosphate accumulation, pH change, exogenous enzyme addition, or the need for expensive high-energy phosphate compounds.
References
- Kim TW, Keum JW, Oh IS, Choi CY, Park CG, and Kim DM. Simple procedures for the construction of a robust and cost-effective cell-free protein synthesis system. J Biotechnol. 2006 Dec 1;126(4):554-61. DOI:10.1016/j.jbiotec.2006.05.014 |
- Noireaux V, Bar-Ziv R, Godefroy J, Salman H, and Libchaber A. Toward an artificial cell based on gene expression in vesicles. Phys Biol. 2005 Sep 15;2(3):P1-8. DOI:10.1088/1478-3975/2/3/P01 |
- Pellinen T, Huovinen T, and Karp M. A cell-free biosensor for the detection of transcriptional inducers using firefly luciferase as a reporter. Anal Biochem. 2004 Jul 1;330(1):52-7. DOI:10.1016/j.ab.2004.03.064 |