IGEM:Peking University/2008/Notebook/Group 2/2008/06/20: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
(Autocreate 2008/06/20 Entry for IGEM:Peking_University/2008/Notebook/Group_2)
 
Line 5: Line 5:
|-
|-
| colspan="2"|
| colspan="2"|
==Entry title==
==Primer design==
* Insert your content here.
:'''Primer 1'''
:*Primer name: F-HindIII-Apal-Gal4
:*Sequence(5'to3'):CCCAAGCTTGGGCCCAAGATGAAGCTACTGTCTTCTATCGAACAA
:*Tm:64.9°C
:'''Primer 2'''
:*Primer name: R-EcoRI-Spel-Gal4
:*Sequence(5'to3'):GGGGAATTCACTAGTATTTTACTCTTTTTTTGGGTTTGGTGGGGT
:*Tm:61.3°C




==PCR==
{|border="1" cellspacing="0"
|+ '''TITLE: PCR-Budding Yeast Genome-Gal4-phusion polymerase  50*6ul'''
|-
| ||Volume (μL)
|-
|Template (pPT1)||0.5
|-
|dNTP||1
|-
|Enzyme||0.5
|-
|Buffer||10
|-
|F-HindIII-Apal-Gal4||0.5
|-
|R-EcoRI-Spel-Gal4||0.5
|-
|ddH<sub>2</sub>O||37
|}


::'''conditions'''
{|border="1" cellspacing="0"
|+
|-
|Temperature||Time Length(0:00:00)
|-
| 98°C||00:30
|-
| 98°C||00:10||30 cycles
|-
| 57.1,60.4,62.5,64.7,66.9,68.9°C||00:30||30 cycles
|-
| 72°C||01:30||30 cycles
|-
| 72°C||07:00
|-
| 4°C||Hold
|}
<hr class=divider>
::'''Enzyme cutting-pPT1-XbaI-20 μL'''
{|border="1" cellspacing="0"
|+
|-
| ||Volumn(μL)
|-
| plasmid||5
|-
| XbaI||0.2
|-
| BSA ||2
|-
| M Buffer||2
|-
|ddH<sub>2</sub>O||10.8
|}
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
<!-- ## Do not edit below this line unless you know what you are doing. ## -->
|}
|}

Revision as of 12:20, 22 July 2008

Group 2 <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Primer design

Primer 1
  • Primer name: F-HindIII-Apal-Gal4
  • Sequence(5'to3'):CCCAAGCTTGGGCCCAAGATGAAGCTACTGTCTTCTATCGAACAA
  • Tm:64.9°C
Primer 2
  • Primer name: R-EcoRI-Spel-Gal4
  • Sequence(5'to3'):GGGGAATTCACTAGTATTTTACTCTTTTTTTGGGTTTGGTGGGGT
  • Tm:61.3°C


PCR

TITLE: PCR-Budding Yeast Genome-Gal4-phusion polymerase 50*6ul
Volume (μL)
Template (pPT1) 0.5
dNTP 1
Enzyme 0.5
Buffer 10
F-HindIII-Apal-Gal4 0.5
R-EcoRI-Spel-Gal4 0.5
ddH2O 37
conditions
Temperature Time Length(0:00:00)
98°C 00:30
98°C 00:10 30 cycles
57.1,60.4,62.5,64.7,66.9,68.9°C 00:30 30 cycles
72°C 01:30 30 cycles
72°C 07:00
4°C Hold


Enzyme cutting-pPT1-XbaI-20 μL
Volumn(μL)
plasmid 5
XbaI 0.2
BSA 2
M Buffer 2
ddH2O 10.8