IGEM:UNAM/2009/Notebook/Modeling logbook Claudia/2010/10/03

From OpenWetWare
Jump to navigationJump to search
UNAM-Genomics-Mexico team <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Repeated experiment: Working on LovTAP.Reporter systems: PCR to fuse trpL promoter

Due to the primer with the trpL promoter was designed by Zepeda without taking into account that the promoter region had two SpeI sites, thus being wrong the usage of an SpeI site in front of it, I had to design a new primer changing the SpeI site by an NheI site.

Experimental Setup

1.Insert the trpL promoter through a PCR reaction to the plasmid pSB1C3.

-trpL promoter sequence

tggcaaatattctgaaatgagctgttgacaattaatcatcgaactagttaactagtacgcAagttcacgtaaaaagggtat

NewcPrimer designed

-Primer_trpL_reverse (5'->3'): NheI site + trpL promoter + XbaI site + EcoRI site TTGCTAGCGTGAACTTGCGTACTAGTTAACTAGTTCGATGATTAATTGTCAACAGCCTCTAGAAGCGGCCGCGAATTC

-Primer forward (5'->3'): Suffix

-Template: Plasmid pSB1C3

  • PCR taq platinum reaction mixture
Reactive Quantity
Buffer 10X PCR Buffer minus M 5μL
10mM dNTP mixture 1μL
50mM MgCl2 1.5μL
Primer mix (10μΜ each) 1μL each
Template DNA (plasmid pSB1C3)Dilutions (1:5, 1:10 and 1:20) 1μL
Platinum Taq DNA polymerase 0.2μL
HPLC Up to a final volume of 50 μL of the mixture (39.3 μL)
  • 35 PCR programmed cycles:

The reaction starts at 95°C during 5 min.

Each cycle is programmed as follows:

Temperature Time
94°C 45s
55°C, 58°C and 60°C 45s
72°C 2:30 min

After the cycle 35, the temperature changes to 72°C during 5 min and ends at 4°C.

Results:PCR with promoter trpL

Taq platinum PCR trpL+pSB1C3. Lane1:Ladder. Lanes 2 and 3: PCR amplified product trpL+pSB1C3 Tm at 58°C and 60°C, respectively. Template Dilution (1:5). Lanes 4 and 5: PCR amplified product trpL+pSB1C3 Tm at 55°C and 58°C, respectively. Template Dilution (1:10). Lanes 6 and 7: PCR amplified product trpL+pSB1C3 Tm at 55°C and 58°C, respectively. Template Dilution (1:20).



Retrieved from "https://openwetware.org/mediawiki/index.php?title=IGEM:UNAM/2009/Notebook/Modeling_logbook_Claudia/2010/10/03&oldid=461699"