JL071106-Construction of pSB1A2-J23012

From OpenWetWare
Revision as of 14:35, 11 July 2006 by Samanthaliang (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

[SpecR]
PCR JL1/JL2 on wt. pSPlam (917bp, EcoRI/SpeI, Neb2)
Paste into pSB1A2-I13521 (EcoRI/SpeI, Neb2, Large 2062)
Product is pSB1A2-J23012

JL1 Forward EcoRI oligo to bioBrick SpecR:
gacttgaattcgcggccgcttctagagtccaagcgagctcgatatc
JL2 Reverse SpeI oligo to bioBrick SpecR:
ccgctactagtCAGCAACGATGTTACGCAGC

Retrieved from "https://openwetware.org/mediawiki/index.php?title=JL071106-Construction_of_pSB1A2-J23012&oldid=49040"