Talk:20.109(S08):Start-up protein engineering (Day1)

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 81: Line 81:
|GTTTTTGACAAGGATGGGAACTGGTACATCAGCGCTGCTCAG
|GTTTTTGACAAGGATGGGAACTGGTACATCAGCGCTGCTCAG
|-
|-
-
|
+
|Yellow
-
|
+
|D 334 H
-
|
+
|5' GAT ATG ATC AAT GAA GTC CAT GCT GAT GGC AAT GGA ACG 3'
-
|
+
|D 334 I
-
|
+
|5' GAT ATG ATC AAT GAA GTC ATT GCT GAT GGC AAT GGA ACG 3'
|-
|-
|GREEN
|GREEN

Revision as of 17:17, 12 March 2008

TR lab

Team colour Mutant 1 Primer 1 (forward) Mutant 2 Primer 2 (forward)
Red D133R GGGAAGCAGATATCGATGGTCGTGGCCAAGTAAACTATGAAG D133W GGGAAGCAGATATCGATGGTTGGGGCCAAGTAAACTATGAAGAG
Purple Y64P GCTGATGGCAATGGAACGATTCCCTTTCCTGAATTTCTTACTATG Y64K GCTGATGGCAATGGAACGATTAAGTTTCCTGAATTTCTTACTATG
Blue G98D GACAAGGATGGGAACGACTACATCAGCGCTGCTCAGTTACGTC G98P GACAAGGATGGGAACCCCTACATCAGCGCTGCTCAGTTACGTC
Pink G96D CGTGTTTTTGACAAGGATGACAACGGCTACATCAGCGCTGC G96K GTTTTTGACAAGGATAAGAACGGCTACATCAGCGCTGCTCAG
Yellow T28D CGACAAGGATGGGGACGGCACCATCGACACAAAGGAAC T28R GATGGGGACGGCACCATCAGGACAAAGGAACTTGGCACCG
Green Y64D GGCAATGGAACGATTGACTTTCCTGAATTTCTGACTATGATGGC Y64H GGCAATGGAACGATTCACTTTCCTGAATTTCTCACTATGATGGC


WF lab

Team colour Mutant 1 Primer 1 (forward) Mutant 2 Primer 2 (forward
PINK D56->P CTTCTCATTATTCCCCAAGGATGGGGACGGCACCATCACC D56->R CTTCTCATTATTCCGCAAGGATGGGGACGGCACCATCACC
PURPLE S101->L GATGGGAACGGCTACATCCTCGCTGCTCAG S101->T GATGGGAACGGCTACATCACCGCTGCTCAG
BLUE N60->E GATGCTGATGGCGAAGGAACGATTTAC N60->K GATGCTGATGGCAAGGGAACGATTTAC
RED G98->P GTTTTTGACAAGGATGGGAACCCCTACATCAGCGCTGCTCAG G98->W GTTTTTGACAAGGATGGGAACTGGTACATCAGCGCTGCTCAG
Yellow D 334 H 5' GAT ATG ATC AAT GAA GTC CAT GCT GAT GGC AAT GGA ACG 3' D 334 I 5' GAT ATG ATC AAT GAA GTC ATT GCT GAT GGC AAT GGA ACG 3'
GREEN K94->H gcattccgtgtttttgacCACgatgggaacggctacatcagcgct K94->A gcattccgtgtttttgacGCGgatgggaacggctacatcagcgct
Personal tools