User:Floriane Briere/Notebook/CHEM-496/2011/11/01: Difference between revisions
From OpenWetWare
mNo edit summary |
|||
(One intermediate revision by the same user not shown) | |||
Line 37: | Line 37: | ||
In tube 1, we obtained an incolore solution with a black/dark purple aggregate. | In tube 1, we obtained an incolore solution with a black/dark purple aggregate. | ||
[[Image:1nov-GoldNPs result.jpg]] | |||
In tube 2, nothing happened, the solution remained incolore and no fibers or filaments was formed. | In tube 2, nothing happened, the solution remained incolore and no fibers or filaments was formed. | ||
Revision as of 17:20, 8 December 2011
File:BDLlogo notext ir.png Project name | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
ObjectiveToday we are going to conduct two different experiments:
Protocol
The forward primer is 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC3' and the reverse primer is 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA3' ResultsIn tube 1, we obtained an incolore solution with a black/dark purple aggregate.
|