User:Nader A. Khamis/Notebook/Experimental Biological Chemistry AU Fall 2011/2011/10/12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 32: Line 32:




*DNA Sequencing
*The DNA Sequence
 
(ATG)CGGGGTTCT(CATCATCATCATCATCAT)GGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTC(GGGATCTGTACGACGATGACGATAAG)(GAT)
 
(Start Codon) - (Histidine Tag) - (Enterokinase Cleavage) - (Target Codon)
 
* The target codon, GAT, remained the same, indicating that mutation was not successful.


==Notes==
==Notes==

Revision as of 11:41, 9 December 2011

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>


Objective

  • Create another Four Point probe. First trial on October 11th failed.
  • The four point probe was chosen over the two point probe because it's more accurate in terms of determining conductivity.
  • Determine if Green Fluorescent Protein (GFP) mutation was successful using the DNA sequence obtained.

Description

  1. A small Teflon paper was prepared.
  2. Four short palladium foils were prepared with the following dimensions:
  • (4.8mm by 6.3mm), Area= 30.24mm2
  • (2.3mm by 7.4mm), Area= 17.02mm2
  • (2.2mm by 7.4mm), Area= 16.28mm2
  • (3mm by 7.5mm), Area= 22.5mm2

Following the preparation:

  1. Each palladium wire was glued to a palladium foil using CircuitWorks® 5 Minute Conductive Epoxy.
  2. The foil was glued to the teflon.
  3. A heat gun was used to accelerate the drying of the glue.

Data

  • The conjugated gold nanoparticles fibers prepared from the previous experiment were pipetted onto the four point probe. The concentration of the fiber was insufficient to run the conductivity test.


  • The DNA Sequence

(ATG)CGGGGTTCT(CATCATCATCATCATCAT)GGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTC(GGGATCTGTACGACGATGACGATAAG)(GAT)

(Start Codon) - (Histidine Tag) - (Enterokinase Cleavage) - (Target Codon)

  • The target codon, GAT, remained the same, indicating that mutation was not successful.

Notes

This area is for any observations or conclusions that you would like to note.


Use categories like tags. Change the "Course" category to the one corresponding to your course. The "Miscellaneous" tag can be used for particular experiments, as instructed by your professor. Please be sure to change or delete this tag as required so that the categories remain well organized. .


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Nader_A._Khamis/Notebook/Experimental_Biological_Chemistry_AU_Fall_2011/2011/10/12&oldid=571996"